COVID-19 CLOSURE

COVID-19 Closure

Due to the current situation with Covid 19 this facility is currently closed and all staff are working from home. Although we will be checking emails regularly, there may be a longer delay than usual in replying.

cDNA Clone - UVRAG

Name: UVRAG
Price per aliquot: £110.00
Expressed:
3xFLAG UVRAG S508A
Plasmid:
pcDNA5D FRT/TO 3xflag UVRAG S508A
Parent Plasmid:
pcDNA5D frt/TO 3FLAG
View Parent Plasmid

|
DU Number:
DU27068
Species:
Human
Sequence of Insert:
View Sequence

GGATCTATGAGCGCCTCCGCGTCGGTCGGGGGCCAGGTCCCCCAGCCACCCCCGGGCCCGGCCGCTGCTCTGCCTCCCGGTTCTGCCGCGCGGGCCCTGCATGTGGAGCTGCCGTCTCAGCAGCGGCGTCTTCGACATCTTCGGAACATTGCTGCCCGGAACATTGTTAATAGAAATGGCCATCAGCTCCTTGATACCTACTTTACACTTCACTTGTGTAGTACTGAAAAGATATATAAAGAATTTTATAGAAGTGAAGTGATTAAGAATTCCTTGAATCCCACGTGGCGAAGTCTCGATTTTGGAATTATGCCAGACCGTCTTGATACATCTGTGTCTTGTTTCGTGGTGAAGATATGGGGTGGAAAGGAGAACATCTACCAGCTGTTGATTGAATGGAAAGTCTGTTTGGATGGGCTGAAATACTTGGGTCAGCAGATTCATGCCCGAAACCAAAATGAAATAATTTTTGGGCTGAATGATGGATACTATGGTGCTCCATTTGAACATAAGGGTTATTCAAATGCTCAGAAGACTATTCTTCTGCAGGTGGATCAGAACTGTGTTCGCAATTCTTACGATGTCTTCTCTTTGCTACGGCTTCATAGAGCCCAGTGTGCAATTAAACAGACTCAGGTAACTGTTCAGAAAATTGGAAAGGAAATTGAAGAAAAACTAAGACTCACATCTACAAGCAATGAACTGAAAAAAAAAAGTGAATGCCTGCAGTTAAAAATTTTGGTGCTTCAGAATGAACTGGAACGGCAGAAGAAAGCTTTGGGACGGGAGGTGGCATTACTGCATAAGCAACAAATTGCATTACAAGACAAAGGAAGTGCATTTTCAGCTGAGCACCTCAAACTTCAACTCCAGAAGGAATCCCTAAATGAGCTGAGGAAGGAGTGCACTGCAAAAAGAGAACTCTTCTTGAAGACTAATGCTCAGTTGACAATTCGTTGCAGGCAGTTACTCTCTGAGCTTTCCTACATTTACCCTATTGATTTGAATGAACATAAGGATTACTTTGTATGCGGTGTCAAGTTGCCTAATTCTGAGGACTTCCAAGCAAAAGATGATGGAAGCATTGCTGTTGCCCTTGGTTATACTGCACATCTGGTCTCCATGATTTCCTTTTTCCTACAAGTGCCCCTCAGATATCCTATAATTCATAAGGGGTCTAGATCAACAATCAAAGACAATATCAATGACAAACTGACGGAAAAGGAGAGAGAGTTTCCACTGTATCCAAAAGGAGGGGAGAAGTTGCAGTTTGATTATGGTGTCTATCTTCTGAACAAAAATATAGCACAGCTAAGATATCAACATGGACTAGGGACTCCAGACTTGCGGCAAACCCTTCCCAACCTGAAAAACTTCATGGAGCATGGACTAATGGTCAGGTGTGACAGACATCACACCTCCAGTGCAATCCCTGTTCCTAAGAGACAAAGCTCCATATTTGGGGGTGCAGATGTAGGCTTCTCTGGGGGGATCCCTTCACCAGACAAAGGACATCGAAAACGGGCCGCCTCTGAGAATGAGAGACTTCAGTACAAAACCCCTCCTCCCAGTTACAACTCAGCATTAGCCCAGCCTGTGACCACCGTCCCCTCCATGGGAGAGACCGAGAGAAAGATAACATCTCTATCCTCCTCCTTGGATACCTCCTTGGACTTCTCCAAAGAAAACAAGAAAAAAGGAGAGGATCTAGTTGGCAGCTTAAACGGAGGCCACGCGAATGTGCACCCTAGCCAAGAACAAGGAGAAGCCCTCTCCGGGCACCGGGCCACAGTCAATGGCACTCTCCTACCCAGCGAGCAGGCCGGGTCCGCCAGTGTCCAGCTTCCAGGCGAGTTCCACCCAGTCTCAGAAGCTGAGCTCTGCTGTACTGTGGAGCAAGCAGAAGAAATCATCGGGCTGGAAGCCACAGGTTTCGCCTCAGGTGATCAGCTAGAAGCATTTAACTGCATCCCAGTGGACAGTGCTGTGGCAGTAGAGTGTGACGAACAAGTTCTGGGAGAATTTGAAGAGTTCTCCCGAAGGATCTATGCACTGAATGAAAACGTATCCAGCTTCCGCCGGCCGCGCAGGAGTTCCGATAAGTGAGCGGCCGC
Amino Acid Sequence:
View Sequence

MDYKDDDDKGSDYKDDDDKDYKDDDDKGSMSASASVGGQVPQPPPGPAAALPPGSAARALHVELPSQQRRLRHLRNIAARNIVNRNGHQLLDTYFTLHLCSTEKIYKEFYRSEVIKNSLNPTWRSLDFGIMPDRLDTSVSCFVVKIWGGKENIYQLLIEWKVCLDGLKYLGQQIHARNQNEIIFGLNDGYYGAPFEHKGYSNAQKTILLQVDQNCVRNSYDVFSLLRLHRAQCAIKQTQVTVQKIGKEIEEKLRLTSTSNELKKKSECLQLKILVLQNELERQKKALGREVALLHKQQIALQDKGSAFSAEHLKLQLQKESLNELRKECTAKRELFLKTNAQLTIRCRQLLSELSYIYPIDLNEHKDYFVCGVKLPNSEDFQAKDDGSIAVALGYTAHLVSMISFFLQVPLRYPIIHKGSRSTIKDNINDKLTEKEREFPLYPKGGEKLQFDYGVYLLNKNIAQLRYQHGLGTPDLRQTLPNLKNFMEHGLMVRCDRHHTSSAIPVPKRQSSIFGGADVGFSGGIPSPDKGHRKRAASENERLQYKTPPPSYNSALAQPVTTVPSMGETERKITSLSSSLDTSLDFSKENKKKGEDLVGSLNGGHANVHPSQEQGEALSGHRATVNGTLLPSEQAGSASVQLPGEFHPVSEAELCCTVEQAEEIIGLEATGFASGDQLEAFNCIPVDSAVAVECDEQVLGEFEEFSRRIYALNENVSSFRRPRRSSDK*
Antibiotic:
Amp

Do you need any help? Please get in touch and we’ll be happy to lend a hand.