COVID-19 CLOSURE

COVID-19 Closure

Due to the current situation with Covid 19 this facility is currently closed and all staff are working from home. Although we will be checking emails regularly, there may be a longer delay than usual in replying.

cDNA Clone - MRCK

Name: MRCK
Price per aliquot: £110.00
Expressed:
HA MRCK beta 1-473 D218A
Plasmid:
pcDNA FRT/TO HA MRCK beta 1-473 D218A
Parent Plasmid:
pcDNA FRT/TO
View Parent Plasmid

|
DU Number:
DU55248
Genbank:
Sequence of Insert:
View Sequence

GGATCCATGTCGGCCAAGGTGCGGCTCAAGAAGCTGGAGCAGCTGCTCCTGGACGGGCCCTGGCGCAACGAGAGCGCCCTGAGCGTGGAAACGCTGCTCGACGTGCTCGTCTGCCTGTACACCGAGTGCAGCCACTCGGCCCTGCGCCGCGACAAGTACGTGGCCGAGTTCCTCGAGTGGGCTAAACCATTTACACAGCTGGTGAAAGAAATGCAGCTTCATCGAGAAGACTTTGAAATAATTAAAGTAATTGGAAGAGGTGCTTTTGGTGAGGTTGCTGTTGTCAAAATGAAGAATACTGAACGAATTTATGCAATGAAAATCCTCAACAAGTGGGAGATGCTGAAAAGAGCAGAGACCGCGTGCTTCCGAGAGGAGCGCGATGTGCTGGTGAACGGCGACTGCCAGTGGATCACCGCGCTGCACTACGCCTTTCAGGACGAGAACCACCTGTACTTAGTCATGGATTACTATGTGGGTGGTGATTTACTGACCCTGCTCAGCAAATTTGAAGACAAGCTTCCGGAAGATATGGCGAGGTTCTACATTGGTGAAATGGTGCTGGCCATTGACTCCATCCATCAGCTTCATTACGTGCACAGAGACATTAAACCTGACAATGTCCTTTTGGACGTGAATGGTCATATCCGCCTGGCTGCCTTTGGATCATGTTTGAAGATGAATGATGATGGCACTGTGCAGTCCTCCGTGGCCGTGGGCACACCTGACTACATCTCGCCGGAGATCCTGCAGGCGATGGAGGACGGCATGGGCAAATACGGGCCTGAGTGTGACTGGTGGTCTCTGGGTGTCTGCATGTATGAGATGCTCTATGGAGAAACGCCGTTTTATGCGGAGTCACTCGTGGAGACCTATGGGAAGATCATGAACCATGAAGAGCGATTCCAGTTCCCATCCCATGTCACGGATGTATCTGAAGAAGCGAAGGACCTCATCCAGAGACTGATCTGCAGTAGAGAACGCCGGCTGGGGCAGAATGGAATAGAGGATTTCAAAAAGCATGCGTTTTTTGAAGGTCTAAATTGGGAAAATATACGAAACCTAGAAGCACCTTATATTCCTGATGTGAGCAGTCCCTCTGACACATCCAACTTCGACGTGGATGACGACGTGCTGAGAAACACGGAAATATTACCTCCTGGTTCTCACACAGGCTTTTCTGGATTACATTTGCCATTCATTGGTTTTACATTCACAACGGAAAGCTGTTTTTCTGATCGAGGCTCTCTGAAGAGCATAATGCAGTCCAACACATTAACCAAAGATGAGGATGTGCAGCGGGACCTGGAGCACAGCCTGCAGATGGAAGCTTACGAGAGGAGGATTCGGAGGCTGGAACAGGAGAAGCTGGAGCTGAGCAGGAAGCTGCAAGAGTCCACCCAGACCGTGCAGTCCCTCCACGGCTGAGCGGCCGC
Amino Acid Sequence:
View Sequence

MYPYDVPDYAGSMSAKVRLKKLEQLLLDGPWRNESALSVETLLDVLVCLYTECSHSALRRDKYVAEFLEWAKPFTQLVKEMQLHREDFEIIKVIGRGAFGEVAVVKMKNTERIYAMKILNKWEMLKRAETACFREERDVLVNGDCQWITALHYAFQDENHLYLVMDYYVGGDLLTLLSKFEDKLPEDMARFYIGEMVLAIDSIHQLHYVHRDIKPDNVLLDVNGHIRLAAFGSCLKMNDDGTVQSSVAVGTPDYISPEILQAMEDGMGKYGPECDWWSLGVCMYEMLYGETPFYAESLVETYGKIMNHEERFQFPSHVTDVSEEAKDLIQRLICSRERRLGQNGIEDFKKHAFFEGLNWENIRNLEAPYIPDVSSPSDTSNFDVDDDVLRNTEILPPGSHTGFSGLHLPFIGFTFTTESCFSDRGSLKSIMQSNTLTKDEDVQRDLEHSLQMEAYERRIRRLEQEKLELSRKLQESTQTVQSLHG*
Antibiotic:
Amp
Comments:
Please clone HA tagged MRCK beta res 1-473 with the mutation D218A into pcDNA5 FRT/TO. Thank you!

Do you need any help? Please get in touch and we’ll be happy to lend a hand.