cDNA Clone - MRCK

Name: MRCK
Price per aliquot: £100.00
Expressed:
HA MRCK beta 1-473 D218A
Plasmid:
pcDNA FRT/TO HA MRCK beta 1-473 D218A
Parent Plasmid:
pcDNA FRT/TO
View Parent Plasmid

|
DU Number:
DU55248
Sequence of Insert:
View Sequence

GGATCCATGTCGGCCAAGGTGCGGCTCAAGAAGCTGGAGCAGCTGCTCCTGGACGGGCCCTGGCGCAACGAGAGCGCCCTGAGCGTGGAAACGCTGCTCGACGTGCTCGTCTGCCTGTACACCGAGTGCAGCCACTCGGCCCTGCGCCGCGACAAGTACGTGGCCGAGTTCCTCGAGTGGGCTAAACCATTTACACAGCTGGTGAAAGAAATGCAGCTTCATCGAGAAGACTTTGAAATAATTAAAGTAATTGGAAGAGGTGCTTTTGGTGAGGTTGCTGTTGTCAAAATGAAGAATACTGAACGAATTTATGCAATGAAAATCCTCAACAAGTGGGAGATGCTGAAAAGAGCAGAGACCGCGTGCTTCCGAGAGGAGCGCGATGTGCTGGTGAACGGCGACTGCCAGTGGATCACCGCGCTGCACTACGCCTTTCAGGACGAGAACCACCTGTACTTAGTCATGGATTACTATGTGGGTGGTGATTTACTGACCCTGCTCAGCAAATTTGAAGACAAGCTTCCGGAAGATATGGCGAGGTTCTACATTGGTGAAATGGTGCTGGCCATTGACTCCATCCATCAGCTTCATTACGTGCACAGAGACATTAAACCTGACAATGTCCTTTTGGACGTGAATGGTCATATCCGCCTGGCTGCCTTTGGATCATGTTTGAAGATGAATGATGATGGCACTGTGCAGTCCTCCGTGGCCGTGGGCACACCTGACTACATCTCGCCGGAGATCCTGCAGGCGATGGAGGACGGCATGGGCAAATACGGGCCTGAGTGTGACTGGTGGTCTCTGGGTGTCTGCATGTATGAGATGCTCTATGGAGAAACGCCGTTTTATGCGGAGTCACTCGTGGAGACCTATGGGAAGATCATGAACCATGAAGAGCGATTCCAGTTCCCATCCCATGTCACGGATGTATCTGAAGAAGCGAAGGACCTCATCCAGAGACTGATCTGCAGTAGAGAACGCCGGCTGGGGCAGAATGGAATAGAGGATTTCAAAAAGCATGCGTTTTTTGAAGGTCTAAATTGGGAAAATATACGAAACCTAGAAGCACCTTATATTCCTGATGTGAGCAGTCCCTCTGACACATCCAACTTCGACGTGGATGACGACGTGCTGAGAAACACGGAAATATTACCTCCTGGTTCTCACACAGGCTTTTCTGGATTACATTTGCCATTCATTGGTTTTACATTCACAACGGAAAGCTGTTTTTCTGATCGAGGCTCTCTGAAGAGCATAATGCAGTCCAACACATTAACCAAAGATGAGGATGTGCAGCGGGACCTGGAGCACAGCCTGCAGATGGAAGCTTACGAGAGGAGGATTCGGAGGCTGGAACAGGAGAAGCTGGAGCTGAGCAGGAAGCTGCAAGAGTCCACCCAGACCGTGCAGTCCCTCCACGGCTGAGCGGCCGC
Amino Acid Sequence:
View Sequence

MYPYDVPDYAGSMSAKVRLKKLEQLLLDGPWRNESALSVETLLDVLVCLYTECSHSALRRDKYVAEFLEWAKPFTQLVKEMQLHREDFEIIKVIGRGAFGEVAVVKMKNTERIYAMKILNKWEMLKRAETACFREERDVLVNGDCQWITALHYAFQDENHLYLVMDYYVGGDLLTLLSKFEDKLPEDMARFYIGEMVLAIDSIHQLHYVHRDIKPDNVLLDVNGHIRLAAFGSCLKMNDDGTVQSSVAVGTPDYISPEILQAMEDGMGKYGPECDWWSLGVCMYEMLYGETPFYAESLVETYGKIMNHEERFQFPSHVTDVSEEAKDLIQRLICSRERRLGQNGIEDFKKHAFFEGLNWENIRNLEAPYIPDVSSPSDTSNFDVDDDVLRNTEILPPGSHTGFSGLHLPFIGFTFTTESCFSDRGSLKSIMQSNTLTKDEDVQRDLEHSLQMEAYERRIRRLEQEKLELSRKLQESTQTVQSLHG*
Antibiotic:
Amp
Comments:
Please clone HA tagged MRCK beta res 1-473 with the mutation D218A into pcDNA5 FRT/TO. Thank you!

Do you need any help? Please get in touch and we’ll be happy to lend a hand.