cDNA Clone - SNX9

Name: SNX9
Price per aliquot: £110.00
Plasmid:
pMK-RQ SNX9 Nter 3FNeon
Parent Plasmid:
pMK-RQ
View Parent Plasmid

Snapgene File | Genbank File
ctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtggccgctacagggcgctcccattcgccattcaggctgcgcaactgttgggaagggcgtttcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgacgtaatacgactcactatagggcgaattgaaggaaggccgtcaaggccgcatccctgggcctcatgggccttcctttcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaacatggtcatagctgtttccttgcgtattgggcgctctccgcttcctcgctcactgactcgctgcgctcggtcgttcgggtaaagcctggggtgcctaatgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttattagaaaaattcatccagcagacgataaaacgcaatacgctggctatccggtgccgcaatgccatacagcaccagaaaacgatccgcccattcgccgcccagttcttccgcaatatcacgggtggccagcgcaatatcctgataacgatccgccacgcccagacggccgcaatcaataaagccgctaaaacggccattttccaccataatgttcggcaggcacgcatcaccatgggtcaccaccagatcttcgccatccggcatgctcgctttcagacgcgcaaacagctctgccggtgccaggccctgatgttcttcatccagatcatcctgatccaccaggcccgcttccatacgggtacgcgcacgttcaatacgatgtttcgcctgatgatcaaacggacaggtcgccgggtccagggtatgcagacgacgcatggcatccgccataatgctcactttttctgccggcgccagatggctagacagcagatcctgacccggcacttcgcccagcagcagccaatcacggcccgcttcggtcaccacatccagcaccgccgcacacggaacaccggtggtggccagccagctcagacgcgccgcttcatcctgcagctcgttcagcgcaccgctcagatcggttttcacaaacagcaccggacgaccctgcgcgctcagacgaaacaccgccgcatcagagcagccaatggtctgctgcgcccaatcatagccaaacagacgttccacccacgctgccgggctacccgcatgcaggccatcctgttcaatcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccac
DU Number:
DU52352
Genbank:
Species:
Human
Synonyms:
SDP1, SH3PX1, SH3PXD3A, WISP
Sequence of Insert:
View Sequence

gcggccgcCAAGCAATCCTCCCGCCTCAGTTTTTTCAGTAGCTGGTACTACAGGTGCTGGCTACAATGCCCAGCTAATTTTTCTTTAATTTTTTGGTAGAGATGGAATCTCGCTTTGTTGCTCAGGCTGGTCTCGAACCCCTGGCCTCAAGCAATCCTCCTGCTATTTAGTCTCCCAAGTAGCAGGGATTGCAGGTGTGAGCTGCTGCACTCAACCAAAATAGGTATATTTCGAGTAACTTTTTTAGGGTTGATCTCTAAATGCAATGTGGGCAGCTGCCAGAAACCTTCCCTGCCTCCGGAACAGAACAGGGCTATCACCGTTGGTGTTATTCTTCCTCAGAGTAGAGCAGATGAGTCATTTTGGTAATGTCTTCCTTTCTTCCAAAACAGCCACAGCCACTATCATGTTTGTACCAGCATGCTTAGAAAGTGAACTGTACACCTTTTGTGTTTTTACTACTCTGTTTGTGTTTGTAACATCCTCTTTTCCTCTCCACTCCTGATAGGACTACAAGGACCACGACGGTGACTACAAGGACCACGACATTGACTACAAGGATGACGATGACAAGGTGAGCAAGGGCGAGGAGGATAACATGGCCTCTCTCCCAGCGACACATGAGTTACACATCTTTGGCTCCATCAACGGTGTGGACTTTGACATGGTGGGTCAGGGCACCGGCAATCCAAATGATGGTTATGAGGAGTTAAACCTGAAGTCCACCAAGGGTGACCTCCAGTTCTCCCCCTGGATTCTGGTCCCTCATATCGGGTATGGCTTCCATCAGTACCTGCCCTACCCTGACGGGATGTCGCCTTTCCAGGCCGCCATGGTAGATGGCTCCGGATACCAAGTCCATCGCACAATGCAGTTTGAAGATGGTGCCTCCCTTACTGTTAACTACCGCTACACCTACGAGGGAAGCCACATCAAAGGAGAGGCCCAGGTGAAGGGGACTGGTTTCCCTGCTGACGGTCCTGTGATGACCAACTCGCTGACCGCTGCGGACTGGTGCAGGTCGAAGAAGACTTACCCCAACGACAAAACCATCATCAGTACCTTTAAGTGGAGTTACACCACTGGAAATGGCAAGCGCTACCGGAGCACTGCGCGGACCACCTACACCTTTGCCAAGCCAATGGCGGCTAACTATCTGAAGAACCAGCCGATGTACGTGTTCCGTAAGACGGAGCTCAAGCACTCCAAGACCGAGCTCAACTTCAAGGAGTGGCAAAAGGCCTTTACCGATGTGATGGGCATGGACGAGCTGTACAAGggtggaggcggaggtATGGCCACCAAGGCTCGGGTTATGTATGATTTTGCTGCTGAACCTGGAAATAATGAACTGACtGTTAATGAAGGAGAAATCATCACAATCACAAATCCGGTAAGAGAACTGTACATTCGAGTCTGATTGTCCCATGTGGACTTATTTTTAACAAATCCGGTAAGAGAACTGTACATTCGAGTCTGATTGTCCCATGTGGACTTATTTTTAAGATTTTATTTTTTTGTAAGTTAATCATTCAAACCCACATGATTTTTTTCCTGTTGCTTATGAAATATTGATGGTGAAGTAAGAAGCTGTTATATAAATACAGGAAAAAAGTTCCCTAAAGACAGTTATGTATGTAATTGAGTTTATTATGTCTGCTTATTTTGTATCTTCTTCGATATGTTTATCTTACAATTTTTTAAATTACTTACAACCTTTTAGGTACCCCATAGTTGTCCTGGAACATGGTTCAGTGTGTTTACCCCTAGCATGATAATACTGTATCTCTAGAATAAGTAAAAGATGATGGTGATTTTCCTAAATGTCTTAACTGATTGATCCTATCATCATTTTTCgcggccgc
Amino Acid Sequence:
View Sequence

Antibiotic:
Kan
Comments:
CRISPR Nter 3FNeon KI donor, use in conjunction with guides 52337 and 52343.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.