cDNA Clone - SNX9

Name: SNX9
Price per aliquot: £110.00
Expressed:
SNX9 Nter ex2 KI antisense guide + Cas9 D10A
Plasmid:
pX335 SNX9 Nter ex2 KI antisense
Parent Plasmid:
pX335
View Parent Plasmid

|
DU Number:
DU52343
Genbank:
Species:
Human
Synonyms:
SDP1, SH3PX1, SH3PXD3A, WISP
Sequence of Insert:
View Sequence

GATACATAACCCGAGCCTATC
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp
Comments:
CRISPR Nter KI guide targeting exon 2, use in conjunction with 52337 and a suitable donor.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.