cDNA Clone - SNX9

Name: SNX9
Price per aliquot: £110.00
Expressed:
SNX9 Nter ex2 KI sense guide
Plasmid:
pBABED P U6 SNX9 Nter ex2 KI sense
Parent Plasmid:
pBABED P U6
View Parent Plasmid

Snapgene File | Genbank File
GTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTACGGCCGCAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAACTATGGCCATTTAATGTAAATACTTAAGAAAAAAAACCAAATTAATTTTGATACATGCTGCATGTGAAGACCCCCGCTGACGGGTAGTCAATCACTCAGAGGAGACCCTCCCAAGGCAGCGAGACCACAAGTCGGAAATGAAAGACCCCCGCTGACGGGTAGTCAATCACTCAGAGGAGACCCTCCCAAGGAACAGCGAGACCACAAGTCGGATGCAACTGCAAGAGGGTTTATTGGATACACGGGTACCCGGGCGACTCAGTCAATCGGAGGACTGGCGCCCCGAGTGAGGGGTTGTGGGCTCTTTTATTGAGCTCGGGGAGCAGAAGCGCGCGAACAGAAGCGAGAAGCGAACTGATTGGTTAGTTCAAATAAGGCACAGGGTCATTTCAGGTCCTTGGGGCACCCTGGAAACATCTGATGGTTCTCTAGAAACTGCTGAGGGCTGGACCGCATCTGGGGACCATCTGTTCTTGGCCCTGAGCCGGGGCAGGAACTGCTTACCACAGATATCCTGTTTGGCCCATATTCAGCTGTTCCATCTGTTCTTGGCCCTGAGCCGGGGCAGGAACTGCTTACCACAGATATCCTGTTTGGCCCATATTCAGCTGTTCCATCTGTTCCTGACCTTGATCTGAACTTCTCTATTCTCAGTTATGTATTTTTCCATGCCTTGCAAAATGGCGTTACTTAAGCTAGCTTGCCAAACCTACAGGTGGGGTCTTTCATTCCCCCCTTTTTCTGGAGACTAAATAAAATCTTTTATTTTATCGATGCATGGGGTCGTGCGCTCCTTTCGGTCGGGCGCTGCGGGTCGTGGGGCGGGCGTCAGGCACCGGGCTTGCGGGTCATGCACCAGGTGCGCGGTCCTTCGGGCACCTCGACGTCGGCGGTGACGGTGAAGCCGAGCCGCTCGTAGAAGGGGAGGTTGCGGGGCGCGGAGGTCTCCAGGAAGGCGGGCACCCCGGCGCGCTCGGCCGCCTCCACTCCGGGGAGCACGACGGCGCTGCCCAGACCCTTGCCCTGGTGGTCGGGCGAGACGCCGACGGTGGCCAGGAACCACGCGGGCTCCTTGGGCCGGTGCGGCGCCAGGAGGCCTTCCATCTGTTGCTGCGCGGCCAGCCGGGAACCGCTCAACTCGGCCATGCGCGGGCCGATCTCGGCGAACACCGCCCCCGCTTCGACGCTCTCCGGCGTGGTCCAGACCGCCACCGCGGCGCCGTCGTCCGCGACCCACACCTTGCCGATGTCGAGCCCGACGCGCGTGAGGAAGAGTTCTTGCAGCTCGGTGACCCGCTCGATGTGGCGGTCCGGATCGACGGTGTGGCGCGTGGCGGGGTAGTCGGCGAACGCGGCGGCGAGGGTGCGTACGGCCCTGGGGACGTCGTCGCGGGTGGCGAGGCGCACCGTGGGCTTGTACTCGGTCATGGTAAGCTTTTTGCAAAAGCCTAGGCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGCCATGGGGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACACACATTCCACAGGagatcttacgcggccgcaccggttgcGTCGACGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGGTCTTCGAGAAGACCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGAATTCAGATCCGGCCGGCGCCTAGAGAAGGAGTGAGGGCTGGATAAAGGGAGGATCGAGGCGGGGTCGAACGAGGAGGTTCAAGGGGGAGAGACGGGGCGGATGGAGGAAGAGGAGGCGGAGGCTTAGGGTGTACAAAGGGCTTGACCCAGGGAGGGGGGTCAAAAGCCAAGGCTTCCCAGGTCACGATGTAGGGGACCTGGTCTGGGTGTCCATGCGGGCCAGGTGAAAAGACCTTGATCTTAACCTGGGTGATGAGGTCTCGGTTAAAGGTGCCGTCTCGCGGCCATCCGACGTTAAAGGTTGGCCATTCTGCAGAGCAGAAGGTAACCCAACGTCTCTTCTTGACATCTACCGACTGGTTGTGAGCGATCCGCTCGACATCTTTCCAGTGACCTAAGGTCAAACTTAAGGGAGTGGTAACAGTCTGGCCCTAATTTTCAGACAAATACAGAAACACAGTCAGACAGAGACAACACAGAACGATGCTGCAGCGCTGCAGCAGACAAGACGCGCGGCTTCGGTTCCAAACCGAAAGCAAAAATTCAGACGGAGGCGGGAACTGTTTTAGGTTCTCGTCTCCTACCAGAACCACATATCCTGACGGGGTCGGATTCCACATCGACTCCCTTCCTCAGGTCGGGCCACAAAAACGGCCCCCAAAGTCCCTGGGACGTCTCCCAGGGTTGCGGCCGGGTGTTCAGAACTCGTCAGTTCCACCACGGGTCCGCCAGATACAGAGCTAGTTAGCTAACTAGTACCGACGCAGGCGCATAAAATCAGTCATAGACACTAGACAATCGGACAGACACAGATAAGTTGCTGGCCAGCTTGCCTCCCGGTGGTGGGTCGGTGGTCCCTGGGCAGGGGTCTCCCGATCCCGGACGAGCCCCCAAATGAAAGACCCCCGCTGACGGGTAGTCAATCACTCAGAGGAGACCCTCCCAAGGAACAGCGAGACCACAAGTCGGATGCAACTGCAAGAGGGTTTATTGGATACACGGGTACCCGGGCGACTCAGTCAATCGGAGGACTGGCGCCCCGAGTGAGGGGTTGTGGGCTCTTTTATTGAGCTCGGGGAGCAGAAGCGCGCGAACAGAAGCGAGAAGCGAACTGATTGGTTAGTTCAAATAAGGCACAGGGTCATTTCAGGTCCTTGGGGCACCCTGGAAACATCTGATGGTTCTCTAGAAACTGCTGAGGGCTGGACCGCATCTGGGGACCATCTGTTCTTGGCCCTGAGCCGGGGCAGGAACTGCTTACCACAGATATCCTGTTTGGCCCATATTCAGCTGTTCCATCTGTTCTTGGCCCTGAGCCGGGGCAGGAACTGCTTACCACAGATATCCTGTTTGGCCCATATTCAGGCTGCAG
DU Number:
DU52337
Genbank:
Species:
Human
Synonyms:
SDP1, SH3PX1, SH3PXD3A, WISP
Sequence of Insert:
View Sequence

GACCTGGAAATAATGAACTGA
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp
Comments:
CRISPR Nter KI guide targeting exon 2, use in conjunction with 52343 and a suitable donor.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.