cDNA Clone - SON

Name: SON
Price per aliquot: £110.00
Plasmid:
pSCB SON 1167-1871 template
Parent Plasmid:
pSC-B
View Parent Plasmid

Snapgene File | Genbank File
ATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCCACTGTGGAATTCGCCCTTAAGGGCGAATTCCACATTGGTCGCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCACCGCGGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATTAAATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGTTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCTCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGTTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCTTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATTAGTGTCCTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTTAATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTACAGTTAATTAAAGGGAACAAAAGCTGGCATGTACCGTTCGTATAGCATACATTATACGAACGGTACGCTCCAATTCGCCCTTTAATTAACTGTTCCAACTTTCACCATAATGAAATAAGATCACTACCGGGCGTATTTTTTGAGTTGTCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGGTGCCCTTAAACGCCTGGTTGCTACGCCTGAATAAGTGATAATAAGCGGATGAATGGCAGAAATTCGAAAGCAAATTCGACCCGGTCGTCGGTTCAGGGCAGGGTCGTTAAATAGCCGCTTATGTCTATTGCTGGTTTACCGGTTTATTGACTACCGGAAGCAGTGTGACCGTGTGCTTCTCAAATGCCTGAGGCCAGTTTGCTCAGGCTCTCCCCGTGGAGGTAATAATTGACGATATGATCCTTTTTTTCTGATCAAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTCCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT
DU Number:
DU48868
Species:
Human
Synonyms:
BASS1, C21orf50, DBP-5, NREBP3
Sequence of Insert:
View Sequence

ATGACACCACCATTGCCTCCTGAGGAACCACCAGAGGGTCCAGCATTGCCCACTGAGCAGTCAGCATTAACAGCTGAAAATACTTGGCCTACAGAGGTGCCATCATTACCATCTGAAGAGTCTGTATCGCAGCCTGAGCCTCCTGTGAGTCAAAGTGAGATTTCGGAGCCTTCAGCAGTGCCTACTGATTATTCAGTGTCAGCATCAGATCCCTCAGTTTTAGTATCAGAGGCTGCTGTGACTGTTCCAGAACCACCACCAGAGCCAGAATCTTCAATTACGTTAACACCTGTAGAGTCTGCAGTAGTAGCAGAAGAACATGAAGTTGTTCCAGAGAGACCAGTGACTTGTATGGTATCTGAAACTCCCGCCATGTCAGCTGAACCAACTGTGTTAGCATCAGAGCCTCCTGTTATGTCAGAGACAGCAGAAACATTTGATTCCATGAGAGCCTCAGGACATGTTGCCTCAGAAGTATCTACATCCTTGTTGGTTCCAGCAGTAACTACTCCAGTGCTGGCAGAGAGCATTCTGGAGCCGCCAGCCATGGCTGCCCCAGAGTCTTCAGCTATGGCTGTCCTGGAGTCTTCGGCTGTGACCGTCCTGGAGTCTTCGACTGTGACTGTCCTGGAGTCTTCGACTGTAACTGTCCTGGAGCCTTCGGTTGTGACTGTCCCGGAGCCTCCTGTTGTGGCTGAGCCAGACTATGTTACCATTCCTGTGCCAGTTGTTTCTGCGCTGGAGCCTTCTGTGCCTGTTCTGGAACCAGCGGTGTCAGTCCTTCAACCTTCTATGATTGTTTCAGAACCATCTGTTTCTGTCCAGGAATCGACTGTGACAGTTTCAGAGCCTGCTGTCACAGTCTCAGAGCAGACTCAAGTAATACCAACTGAGGTGGCTATAGAGTCCACACCAATGATACTGGAATCTAGTATCATGTCATCACATGTTATGAAAGGAATTAATCTATCCTCTGGTGATCAAAATCTTGCTCCAGAGATTGGCATGCAGGAGATTGCATTGCATTCAGGTGAAGAACCACATGCTGAGGAACACCTGAAAGGTGACTTTTACGAAAGTGAACATGGTATAAATATAGACCTTAATATAAATAATCATTTAATTGCTAAAGAGATGGAACATAATACAGTGTGTGCTGCTGGTACTAGTCCTGTTGGGGAAATTGGTGAAGAGAAAATTTTGCCCACCAGTGAGACTAAACAGCGCACAGTATTGGATACCTACCCTGGTGTTAGTGAAGCTGATGCAGGAGAAACTCTATCTTCTACTGGTCCTTTTGCTCTGGAACCTGATGCAACAGGAACTAGTAAGGGTATTGAATTTACCACAGCATCTACTCTCAGTTTAGTTAATAAATATGATGTTGATTTATCTTTAACTACTCAAGATACTGAACATGACATGGTAATTTCCACCAGTCCTAGTGGTGGTAGTGAAGCTGACATTGAAGGGCCTTTGCCTGCTAAAGATATTCATCTTGATTTACCATCTAATAATAACCTTGTTAGTAAGGATACAGAAGAACCATTACCTGTAAAAGAGAGTGACCAGACATTAGCAGCTCTGCTCAGCCCTAAAGAAAGTAGTGGAGGAGAAAAAGAAGTACCTCCCCCTCCTAAAGAGACACTGCCTGATTCAGGATTTTCTGCCAATATTGAGGATATTAATGAAGCAGATTTAGTGAGACCGTTACTTCCTAAGGACATGGAACGTCTTACAAGCCTTAGAGCTGGCATTGAAGGACCTTTACTTGCAAGTGATGTTGGACGTGACAGATCTGCTGCCAGCCCGGTTGTAAGTAGTATGCCAGAAAGAGCTTCAGAGTCTTCTTCAGAGGAAAAAGATGATTATGAAATTTTTGTAAAAGTTAAGGACACTCACGAAAAAAGCAAGAAAAATAAGAACCGTGATAAGGGGGAGAAAGAGAAGAAAAGAGACTCTTCATTAAGATCTCGAAGTAAGCGTTCCAAATCTTCTGAACACAAATCACGCAAGCGTACCAGTGAATCTCGTTCTAGGGCAAGAAAGAGATCATCTAAGTCCAAGTCTCATCGCTCTCAGACACGTTCACGGTCACGTTCAAGACGCAGGAGG
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp
Comments:
Gap in sequence data, template only.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.