cDNA Clone - ABIN1

Name: ABIN1
Price per aliquot: £110.00
Plasmid:
pMK-RQ ABIN1 GFP Donor
Parent Plasmid:
pMK-RQ
View Parent Plasmid

Snapgene File | Genbank File
ctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtggccgctacagggcgctcccattcgccattcaggctgcgcaactgttgggaagggcgtttcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgacgtaatacgactcactatagggcgaattgaaggaaggccgtcaaggccgcatccctgggcctcatgggccttcctttcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaacatggtcatagctgtttccttgcgtattgggcgctctccgcttcctcgctcactgactcgctgcgctcggtcgttcgggtaaagcctggggtgcctaatgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttattagaaaaattcatccagcagacgataaaacgcaatacgctggctatccggtgccgcaatgccatacagcaccagaaaacgatccgcccattcgccgcccagttcttccgcaatatcacgggtggccagcgcaatatcctgataacgatccgccacgcccagacggccgcaatcaataaagccgctaaaacggccattttccaccataatgttcggcaggcacgcatcaccatgggtcaccaccagatcttcgccatccggcatgctcgctttcagacgcgcaaacagctctgccggtgccaggccctgatgttcttcatccagatcatcctgatccaccaggcccgcttccatacgggtacgcgcacgttcaatacgatgtttcgcctgatgatcaaacggacaggtcgccgggtccagggtatgcagacgacgcatggcatccgccataatgctcactttttctgccggcgccagatggctagacagcagatcctgacccggcacttcgcccagcagcagccaatcacggcccgcttcggtcaccacatccagcaccgccgcacacggaacaccggtggtggccagccagctcagacgcgccgcttcatcctgcagctcgttcagcgcaccgctcagatcggttttcacaaacagcaccggacgaccctgcgcgctcagacgaaacaccgccgcatcagagcagccaatggtctgctgcgcccaatcatagccaaacagacgttccacccacgctgccgggctacccgcatgcaggccatcctgttcaatcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccac
DU Number:
DU48524
Genbank:
Species:
Human
Synonyms:
TNIP1, ABIN-1, NAF1, VAN, nip40-1
Sequence of Insert:
View Sequence

TGACAGTGTATTAAATATTAGTCAGGGTGTTTTTTTCTTTTCTTTTTTTAAAGAAGATGATACACATATAAATGGAACTTTGGACTGGGTTGACTTGCTTATCCCTTAGGGTACAAGCATTTCACTTTAAAGATTACTAAATTAACTTAAGACTTTCATTTCCCTCCCTCAGAGAGGGGAAGGGACTGCCCATAATCCCATAGTAAATTAATGCCTAGACCATTAATTGAGTAAGTGTTTATTGGGCAAAATTCATAGCTAATACTGTGGTAGGCTCTGAGGATGCAATGATGGGTAAAACATATGGGATTCCTGTTCTTCTGGACCTCACAGACAGGACATGAACTCAGATTTTTTTTTTTCCAAGTCCAGGTTCTTTCTTGTATCCCACATTGCACCCTACTGTTTATTTGGACTCCTGTTCCAAACAAGCCAACAGTGCATTGAGGCTGCTAAGAGAAACTAATGCCATTCTAAGGTTGTATTAATAGAGGCAGAGCGTCCAGATAAAAGGAGGTGACTGTCCTGCTTTACTATAATATGGTCAGACCAGCTTAAAGTGGGGGACTGCCTTCTGGGGCATTGACAGACTAGAGCTTCTCTGCAAAGGATGCCCCCATGGCCTGGCCAGCCTGCTGATATGCTGCTGTTGTCCTTACAGCCAGGCGGGCACCACGGCAGGGGCTGAGCTACCCTCatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagagcggttctGAgGGacGtGGACCGTACaGaATaTAtGAtCCTGGGGGCAGCGTGCCCTCAGGAGAGGCATCCGCAGCTTTTGAGCGCCTAGTGAAGGAGAATTCCCGGCTGAAGGAAAAAATGCAAGGGATAAAGATGTTAGGTAAAGCAGACCCTGTCCCCTCCCTGCGAGCGCCCCTCCCTGCAGACTGTGATGCCAGTCCCTCTACTAGCAGTGGAGAATGAAGCTGGCATATGCCTCTGCCCAAGTCATCCCCTGTCCCTCCTGGCCCAGCGCTGGCTCCTGCCTCACAGCTGTCTCTATGCACCATGTAGCATGGTGACAGTATTCCCAACCCTGATTCCTCAGCACCCGGAAACCAGGATGACAGGACTCAGGTCCAAGAGGGAGGCGTGGGCTAAGGGAAAGGGGGCTGGAAGGCCCAGTTAATGGCCATGGAACTAGAGTGGTCTCCTCTTTCTGGGGCACGAGAGATGGGGAGAGCCAGCATGACCAGGCAACTGGGGCACGCGTTCCTAGGTGTTGGAGCAGGGAGCAGAGCTTGGCTTGAAGCAAGGAGGTGGTAGGTCCCTCAGTTCTCTTCTCCTGGCTCTTGCTCAAGCCATCCCCACTTTAGAACAACCCCACCTCCCTCCACACGACCGACGGGCCCTGTGCATCAGCACCCAGTTGCTGTGCCCCCTTCTCCTCCAGACAAGGCTTTCATTGATTTCCCCATCCAGAGGGGGCTCTCTTTCT
Amino Acid Sequence:
View Sequence

Antibiotic:
Kan
Comments:
Designed to insert an in-frame GFP into the ATG start of the first common coding exon (exon 2 isoform 1). Complete sequence of donor including homology arms shown as sequence of insert, contains several silent mutations to prevent Cas9 targeting the donor sequence. Successful recombination will N-terminally tag Abin1 with GFP.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.