cDNA Clone - ZUFSP

Price per aliquot: £110.00
Parent Plasmid:
pcDNA5D FRT/TO GST 3C Halo Thrombin
View Parent Plasmid

Snapgene File | Genbank File
DU Number:
C6orf113; dJ412I7.3; RP3-412I7.3
Sequence of Insert:
View Sequence

GGATCCatgctttcctgtaatatttgtggtgaaacagtaacctcagaacc agacatgaaagctcacctaattgttcacatggaaagtgaaattatatgtc cattttgcaagttgtcaggtgtgaattatgatgaaatgtgttttcatatc gaaacagctcattttgagcagaatacacttgaaagaaactttgagaggat aaatacagtacaatatggaacttcagataacaagaaagacaacaccctac agtgtggaatggaagttaattcaagtattctttcaggttgtgcatctaat catccaaaaaattcagctcaaaacctgactaaagatagtactttaaaaca tgaaggcttctattcagagaacttaactgaatctagaaaattcctgaaaa gtagggaaaaacagtccagcctgaccgaaataaaaggatctgtttatgaa acaacatacagtcctcctgaatgtccattctgtggaaaaatagaggagca cagtgaagatatggaaactcatgtgaaaacaaagcatgccaatcttttag acattccattggaagactgtgatcaaccactctatgattgtcctatgtgt gggctcatatgtacaaattaccatattcttcaggaacatgttgacttgca tttggaagaaaacagctttcagcaaggcatggatagagtccagtgttctg gtgatctacaattggctcaccagcttcagcaagaagaagacagaaagagg agatctgaagaatcaagacaagaaatagaagaatttcagaagctgcagag acaatatggtttagataattctggaggatacaaacaacaacaactacgaa atatggagatagaagtaaataggggaagaatgcctccatctgaatttcat aggagaaaagctgatatgatggaatcattagctcttggttttgacgatgg aaaaacaaaaacttccggaattattgaagcacttcataggtattatcaga atgctgccacagatgtgagacgggtgtggctttcttcagtggtggatcac tttcattcatctttaggcgacaaaggttggggttgtggttacagaaattt ccaaatgctactttcatcattattacaaaatgatgcttacaacgattgct taaaaggtatgttgattccttgcattccaaaaattcaatctatgattgaa gatgcatggaaggaaggttttgatcctcagggggcctctcaacttaataa caggttacagggaacaaaggcctggattggagcatgtgaagtatatatac tcctgacctccctaagggtaaagtgtcatattgttgattttcacaaatca actggtcctttgggtacacaccctcgcttatttgaatggatattgaacta ttattcttcagagggagaagggagtccaaaggtagtgtgtacatctaaac ctcctatctatcttcagcatcaaggtcacagtcgaactgttattggaatt gaagagaaaaaaaaccgaacattatgcttactaatacttgatcctggatg tccttctcgagaaatgcagaaattattaaagcaagacatagaggctagca gtctcaagcaacttcggaaatctatgggaaatttaaaacataagcaatac cagatattggcagtagagggtgctctttctctagaggagaaacttgccag gagacaagcttctcaagtctttacagccgagaagattccttgaGCGGCCG C
Amino Acid Sequence:
View Sequence

Parental Plasmid DU49011

Do you need any help? Please get in touch and we’ll be happy to lend a hand.