cDNA Clone - ZNRF4

Name: ZNRF4
Price per aliquot: £110.00
Parent Plasmid:
View Parent Plasmid

Snapgene File | Genbank File
DU Number:
spzn, RNF204, Ssrzf1, SPERIZIN
Sequence of Insert:
View Sequence

GGATCCatgccgctctgccgtccggagcacttaatgcctagagccagcag ggtcccagtggccgcgtcactgcctctgagccacgcggtcattccaactc aactgccctcgcgtcctggccacaggccccctgggagaccccggagatgc ccaaaggcctcatgcctgccgcctccagtgggacctagcagcacacagac agcgaagcgggtgaccatggggtggccacggccgggccgagccctcgtgg cagtcaaagccttgctggtcttgtcgctgctccaggtgcccgcgcaggcg gtggtacgggccgtgctggaagacaactcgagctcggtggactttgcgga tctgccggcgctgttcggcgtccccctggcccccgagggcatacggggct acctgatggaggtcaagccagccaacgcgtgccatcccatcgaggccccg cgactgggcaaccgctctctgggcgccatcgtgctgatccgccgctacga ctgcaccttcgacctcaaggtgctgaacgcccagcgcgccggcttcgagg cggccatcgtgcacaacgtccactccgacgacctcgtgagcatgacccac gtctacgaggacttgaggggccagatcgccatcccctcagtgttcgtgag cgaggccgcctcgcaggacctgcgggtcatcctgggctgcaacaagtcgg cccacgcgctgctcctgcccgacgacccaccgtgccacgacctgggctgt caccccgtgctgaccgtgtcctgggtgctgggctgtaccctggccctggt cgtatcagccttctttgtcctgaaccacctgtggctctgggcccaggcct gctgcagccacagacggccggtgaagacgtctacctgccagaaggcccag gtccgcaccttcacgtggcacaacgacctgtgtgccatctgcctggatga gtacgaggagggcgaccaactcaagatcctgccctgctcccacacctacc actgcaaatgcattgacccctggttctcccaagccccccggcgctcctgc cccgtgtgcaaacagtcggtggccgccacagaagacagctttgactccac cacctacagcttcagggacgaggacccctccctaccgggccaccggcccc ccatctgggccattcaagtccagctacgctcccggaggctggagctgctg ggccgcgccagtccccactgccactgcagcaccacgtccctggaggcaga gtataccactgtctcctcagcccctcctgaggcccctggtcagGCGGCCG C
Amino Acid Sequence:
View Sequence

2 silent mutations at nt a294g t948g compared to NCBI ref

Do you need any help? Please get in touch and we’ll be happy to lend a hand.