cDNA Clone - 53BP1

Name: 53BP1
Price per aliquot: £110.00
Plasmid:
pSc-B-53BP1 (Xho1-Kpn1, no stop )
Parent Plasmid:
pSC-B
View Parent Plasmid

Snapgene File | Genbank File
ATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCCACTGTGGAATTCGCCCTTAAGGGCGAATTCCACATTGGTCGCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCACCGCGGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATTAAATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGTTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCTCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGTTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCTTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATTAGTGTCCTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTTAATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTACAGTTAATTAAAGGGAACAAAAGCTGGCATGTACCGTTCGTATAGCATACATTATACGAACGGTACGCTCCAATTCGCCCTTTAATTAACTGTTCCAACTTTCACCATAATGAAATAAGATCACTACCGGGCGTATTTTTTGAGTTGTCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGGTGCCCTTAAACGCCTGGTTGCTACGCCTGAATAAGTGATAATAAGCGGATGAATGGCAGAAATTCGAAAGCAAATTCGACCCGGTCGTCGGTTCAGGGCAGGGTCGTTAAATAGCCGCTTATGTCTATTGCTGGTTTACCGGTTTATTGACTACCGGAAGCAGTGTGACCGTGTGCTTCTCAAATGCCTGAGGCCAGTTTGCTCAGGCTCTCCCCGTGGAGGTAATAATTGACGATATGATCCTTTTTTTCTGATCAAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTCCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT
DU Number:
DU23554
Genbank:
Sequence of Insert:
View Sequence

ctcgagATGGACCCTACTGGAAGTCAGTTGGATTCAGATTTCTCTCAGCAAGATACTCCTTGCCTGATAATTGAAGATTCTCAGCCTGAAAGCCAGGTTCTAGAGGATGATTCTGGTTCTCACTTCAGTATGCTATCTCGACACCTTCCTAATCTCCAGACGCACAAAGAAAATCCTGTGTTGGATGTTGTGTCCAATCCTGAACAAACAGCTGGAGAAGAACGAGGAGACGGTAATAGTGGGTTCAATGAACATTTGAAAGAAAACAAGGTTGCAGACCCTGTGGATTCTTCTAACTTGGACACATGTGGTTCCATCAGTCAGGTCATTGAGCAGTTACCTCAGCCAAACAGGACAAGCAGTGTTCTGGGAATGTCAGTGGAATCTGCTCCTGCTGTGGAGGAAGAGAAGGGAGAAGAGTTGGAACAGAAGGAGAAAGAGAAGGAAGAAGATACTTCAGGCAATACTACACATTCCCTTGGTGCTGAAGATACTGCCTCATCACAGTTGGGTTTTGGGGTTCTGGAACTCTCCCAGAGCCAGGATGTTGAGGAAAATACTGTGCCATATGAAGTGGACAAAGAGCAGCTACAATCAGTAACCACCAACTCTGGTTATACCAGGCTGTCTGATGTGGATGCTAATACTGCAATTAAGCATGAAGAACAGTCCAACGAAGATATCCCCATAGCAGAACAGTCCAGCAAGGACATCCCTGTGACAGCACAGCCCAGTAAGGATGTACATGTTGTAAAAGAGCAAAATCCACCACCTGCAAGGTCAGAGGACATGCCTTTTAGCCCCAAAGCATCTGTTGCTGCTATGGAAGCAAAAGAACAGTTGTCTGCACAAGAACTTATGGAAAGTGGACTGCAGATTCAGAAGTCACCAGAGCCTGAGGTTTTGTCAACTCAGGAAGACTTGTTTGACCAGAGCAATAAAACAGTATCTTCTGATGGTTGCTCTACTCCTTCAAGGGAGGAAGGTGGGTGTTCTTTGGCTTCCACTCCTGCCACCACTCTGCATCTCCTGCAGCTCTCTGGTCAGAGGTCCCTTGTTCAGGACAGTCTTTCCACGAATTCTTCAGATCTTGTTGCTCCTTCTCCTGATGCTTTCCGATCTACTCCTTTTATCGTTCCTAGCAGTCCCACAGAGCAAGAAGGGAGACAAGATAAGCCAATGGACACGTCAGTGTTATCTGAAGAAGGAGGAGAGCCTTTTCAGAAGAAACTTCAAAGTGGTGAACCAGTGGAGTTAGAAAACCCCCCTCTCCTGCCTGAGTCCACTGTATCACCACAAGCCTCAACACCAATATCTCAGAGCACACCAGTCTTCCCTCCTGGGTCACTTCCTATCCCATCCCAGCCTCAGTTTTCTCATGACATTTTTATTCCTTCCCCAAGTCTGGAAGAACAATCAAATGATGGGAAGAAAGATGGAGATATGCATAGTTCATCTTTGACAGTTGAGTGTTCTAAAACTTCAGAGATTGAACCAAAGAATTCCCCTGAGGATCTTGGGCTATCTTTGACAGGGGATTCTTGCAAGTTGATGCTTTCTACAAGTGAATATAGTCAGTCCCCAAAGATGGAGAGCTTGAGTTCTCACAGAATTGATGAAGATGGAGAAAACACACAGATTGAGGATACGGAACCCATGTCTCCAGTTCTCAATTCTAAATTTGTTCCTGCTGAAAATGATAGTATCCTGATGAATCCAGCACAGGATGGTGAAGTACAACTGAGTCAGAATGATGACAAAACAAAGGGAGATGATACAGACACCAGGGATGACATTAGTATTTTAGCCACTGGTTGCAAGGGCAGAGAAGAAACGGTAGCAGAAGATGTTTGTATTGATCTCACTTGTGATTCGGGGAGTCAGGCAGTTCCGTCACCAGCTACTCGATCTGAGGCACTTTCTAGTGTGTTAGATCAGGAGGAAGCTATGGAAATTAAAGAACACCATCCAGAGGAGGGGTCTTCAGGGTCTGAGGTGGAAGAAATCCCTGAGACACCTTGTGAAAGTCAAGGAGAGGAACTCAAAGAAGAAAATATGGAGAGTGTTCCGTTGCACCTTTCTCTGACTGAAACTCAGTCCCAAGGGTTGTGTCTTCAAAAGGAAATGCCAAAAAAAGAATGCTCAGAAGCTATGGAAGTTGAAACCAGTGTGATTAGTATTGATTCCCCTCAAAAGTTGGCAATACTTGACCAAGAATTGGAACATAAGGAACAGGAAGCTTGGGAAGAAGCTACTTCAGAGGACTCCAGTGTTGTCATTGTAGATGTGAAAGAGCCATCTCCCAGAGTTGATGTTTCTTGTGAACCTTTGGAGGGAGTGGAGAAGTGCTCAGATTCCCAGTCATGGGAGGATATTGCTCCAGAAATAGAACCATGTGCTGAGAATAGATTAGACACCAAGGAAGAAAAGAGTGTAGAATATGAAGGAGATCTGAAATCAGGGACTGCAGAAACAGAACCTGTAGAGCAAGATTCTTCACAGCCTTCCTTACCTTTAGTGAGAGCAGATGATCCTTTAAGACTTGACCAGGAGTTGCAGCAGCCCCAAACTCAGGAGAAAACAAGTAATTCATTAACAGAAGACTCAAAAATGGCTAATGCAAAGCAGCTAAGCTCAGATGCAGAGGCCCAGAAGCTGGGGAAGCCCTCTGCCCATGCCTCACAAAGCTTCTGTGAAAGTTCTAGTGAAACCCCATTTCATTTCACTTTGCCTAAAGAAGGTGATATCATCCCACCATTGACTGGTGCAACCCCACCTCTTATTGGGCACCTAAAATTGGAGCCCAAGAGACACAGTACTCCTATTGGTATTAGCAACTATCCAGAAAGCACCATAGCAACCAGTGATGTCATGTCTGAAAGCATGGTGGAGACCCATGATCCCATACTTGGGAGTGGAAAAGGGGATTCTGGGGCTGCCCCAGACGTGGATGATAAATTATGTCTAAGAATGAAACTGGTTAGTCCTGAGACTGAGGCGAGTGAAGAGTCTTTGCAGTTCAACCTGGAAAAGCCTGCAACTGGTGAAAGAAAAAATGGATCTACTGCTGTTGCTGAGTCTGTTGCCAGTCCCCAGAAGACCATGTCTGTGTTGAGCTGTATCTGTGAAGCCAGGCAAGAGAATGAGGCTCGAAGTGAGGATCCCCCCACCACACCCATCAGGGGGAACTTGCTCCACTTTCCAAGTTCTCAAGGAGAAGAGGAGAAAGAAAAATTGGAGGGTGACCATACAATCAGGCAGAGTCAACAGCCTATGAAGCCCATTAGTCCTGTCAAGGACCCTGTTTCTCCTGCTTCCCAGAAGATGGTCATACAAGGGCCATCCAGTCCTCAAGGAGAGGCAATGGTGACAGATGTGCTAGAAGACCAGAAAGAAGGACGGAGTACTAATAAGGAAAATCCTAGTAAGGCCTTGATTGAAAGGCCCAGCCAAAATAACATAGGAATCCAAACCATGGAGTGTTCCTTGAGGGTCCCAGAAACTGTTTCAGCAGCAACCCAGACTATAAAGAATGTGTGTGAGCAGGGGACCAGTACAGTGGACCAGAACTTTGGAAAGCAAGATGCCACAGTTCAGACTGAGAGGGGGAGTGGTGAGAAACCAGTCAGTGCTCCTGGGGATGATACAGAGTCGCTCCATAGCCAGGGAGAAGAAGAGTTTGATATGCCTCAGCCTCCACATGGCCATGTCTTACATCGTCACATGAGAACAATCCGGGAAGTACGCACACTTGTCACTCGTGTCATTACAGATGTGTATTATGTGGATGGAACAGAAGTAGAAAGAAAAGTAACTGAGGAGACTGAAGAGCCAATTGTAGAGTGTCAGGAGTGTGAAACTGAAGTTTCCCCTTCACAGACTGGGGGCTCCTCAGGTGACCTGGGGGATATCAGCTCCTTCTCCTCCAAGGCATCCAGCTTACACCGCACATCAAGTGGGACAAGTCTCTCAGCTATGCACAGCAGTGGAAGCTCAGGGAAAGGAGCCGGACCACTCAGAGGGAAAACCAGCGGGACAGAACCCGCAGATTTTGCCTTACCCAGCTCCCGAGGAGGCCCAGGAAAACTGAGTCCTAGAAAAGGGGTCAGTCAGACAGGGACGCCAGTGTGTGAGGAGGATGGTGATGCAGGCCTTGGCATCAGACAGGGAGGGAAGGCTCCAGTCACGCCTCGTGGGCGTGGGCGAAGGGGCCGCCCACCTTCTCGGACCACTGGAACCAGAGAAACAGCTGTGCCTGGCCCCTTGGGCATAGAGGACATTTCACCTAACTTGTCACCAGATGATAAATCCTTCAGCCGTGTCGTGCCCCGAGTGCCAGACTCCACCAGACGAACAGATGTGGGTGCTGGTGCTTTGCGTCGTAGTGACTCTCCAGAAATTCCTTTCCAGGCTGCTGCTGGCCCTTCTGATGGCTTAGATGCCTCCTCTCCAGGAAATAGCTTTGTAGGGCTCCGTGTTGTAGCCAAGTGGTCATCCAATGGCTACTTTTACTCTGGGAAAATCACACGAGATGTCGGAGCTGGGAAGTATAAATTGCTCTTTGATGATGGGTACGAATGTGATGTGTTGGGCAAAGACATTCTGTTATGTGACCCCATCCCGCTGGACACTGAAGTGACGGCCCTCTCGGAGGATGAGTATTTCAGTGCAGGAGTGGTGAAAGGACATAGGAAGGAGTCTGGGGAACTGTACTACAGCATTGAAAAAGAAGGCCAAAGAAAGTGGTATAAGCGAATGGCTGTCATCCTGTCCTTGGAGCAAGGAAACAGACTGAGAGAGCAGTATGGGCTTGGCCCCTATGAAGCAGTAACACCTCTTACAAAGGCAGCAGATATCAGCTTAGACAATTTGGTGGAAGGGAAGCGGAAACGGCGCAGTAACGTCAGCTCCCCAGCCACCCCTACTGCCTCCAGTAGCAGCAGCACAACCCCTACCCGAAAGATCACAGAAAGTCCTCGTGCCTCCATGGGAGTTCTCTCAGGCAAAAGAAAACTTATCACTTCTGAAGAGGAACGGTCCCCTGCCAAGCGAGGTCGCAAGTCTGCCACAGTAAAACCTGGTGCAGTAGGGGCAGGAGAGTTTGTGAGCCCCTGTGAGAGTGGAGACAACACCGGTGAACCCTCTGCCCTGGAAGAGCAGAGAGGGCCTTTGCCTCTCAACAAGACCTTGTTTCTGGGCTACGCATTTCTCCTTACCATGGCCACAACCAGTGACAAGTTGGCCAGCCGCTCCAAACTGCCAGATGGTCCTACAGGAAGCAGTGAAGAAGAGGAGGAATTTTTGGAAATTCCTCCTTTCAACAAGCAGTATACAGAATCCCAGCTTCGAGCAGGAGCTGGCTATATCCTTGAAGATTTCAATGAAGCCCAGTGTAACACAGCTTACCAGTGTCTTCTAATTGCGGATCAGCATTGTCGAACCCGGAAGTACTTCCTGTGCCTTGCCAGTGGGATTCCTTGTGTGTCTCATGTCTGGGTCCATGATAGTTGCCATGCCAACCAGCTCCAGAACTACCGTAATTATCTGTTGCCAGCTGGGTACAGCCTTGAGGAGCAAAGAATTCTGGACTGGCAACCCCGTGAAAATCCTTTCCAGAATCTGAAGGTACTCTTGGTATCAGACCAACAGCAGAACTTCCTGGAGCTCTGGTCTGAGATCCTCATGACTGGTGGTGCAGCCTCTGTGAAGCAGCACCATTCAAGTGCCCATAACAAAGATATTGCTTTAGGGGTATTTGATGTGGTGGTGACGGACCCCTCATGCCCAGCCTCGGTGCTGAAGTGTGCTGAAGCATTGCAGCTGCCTGTGGTGTCACAAGAGTGGGTGATCCAGTGCCTCATTGTTGGGGAGAGAATTGGATTCAAGCAGCATCCAAAATATAAACACGATTATGTTTCTCACtgGGTACC
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp; Kan

Do you need any help? Please get in touch and we’ll be happy to lend a hand.