cDNA Clone - ACOX2

Name: ACOX2
Price per aliquot: £110.00
Expressed:
GST-ACOX2
Plasmid:
pGEX6P-1 ACOX2
Parent Plasmid:
pGEX6P1
View Parent Plasmid

Snapgene File | Genbank File
ACGTTATCGACTGCACGGTGCACCAATGCTTCTGGCGTCAGGCAGCCATCGGAAGCTGTGGTATGGCTGTGCAGGTCGTAAATCACTGCATAATTCGTGTCGCTCAAGGCGCACTCCCGTTCTGGATAATGTTTTTTGCGCCGACATCATAACGGTTCTGGCAAATATTCTGAAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGTATTCATGTCCCCTATACTAGGTTATTGGAAAATTAAGGGCCTTGTGCAACCCACTCGACTTCTTTTGGAATATCTTGAAGAAAAATATGAAGAGCATTTGTATGAGCGCGATGAAGGTGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCAATCTTCCTTATTATATTGATGGTGATGTTAAATTAACACAGTCTATGGCCATCATACGTTATATAGCTGACAAGCACAACATGTTGGGTGGTTGTCCAAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGAGCGGTTTTGGATATTAGATACGGTGTTTCGAGAATTGCATATAGTAAAGACTTTGAAACTCTCAAAGTTGATTTTCTTAGCAAGCTACCTGAAATGCTGAAAATGTTCGAAGATCGTTTATGTCATAAAACATATTTAAATGGTGATCATGTAACCCATCCTGACTTCATGTTGTATGACGCTCTTGATGTTGTTTTATACATGGACCCAATGTGCCTGGATGCGTTCCCAAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCCACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCATGGCCTTTGCAGGGCTGGCAAGCCACGTTTGGTGGTGGCGACCATCCTCCAAAATCGGATCTGGAAGTTCTGTTCCAGGGGCCCCTGGGATCCCCGGAATTCCCGGGTCGACTCGAGCGGCCGCATCGTGACTGACTGACGATCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATAAATTCCGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTCAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTAACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTGGAATT
DU Number:
DU41535
Genbank:
Species:
Human
Synonyms:
BCOX, BRCACOX, BRCOX, THCCox
Sequence of Insert:
View Sequence

GGATCCATGGGCAGCCCAGTGCACCGAGTGTCATTGGGGGATACCTGGAGCAGGCAAATGCACCCCGACATAGAGAGCGAGAGGTATATGCAGTCCTTTGACGTGGAACGGCTCACCAACATCCTTGATGGAGGTGCCCAGAACACTGCACTCCGCAGGAAAGTTGAGAGCATCATCCACAGTTACCCGGAGTTTAGCTGTAAGGACAATTATTTCATGACCCAGAATGAGCGTTATAAGGCTGCCATGCGGAGGGCATTCCACATCCGGTTGATAGCTCGGCGCCTGGGTTGGTTAGAAGATGGTCGTGAATTAGGCTACGCTTACAGAGCCCTTTCTGGAGACGTGGCCTTAAATATACACAGAGTCTTCGTGAGAGCCCTCAGGAGCCTGGGCTCAGAGGAGCAGATTGCCAAATGGGACCCACTCTGCAAAAACATCCAGATCATCGCAACGTATGCACAGACAGAGTTGGGACATGGGACATATCTTCAGGGCCTGGAGACTGAAGCCACCTATGACGCAGCCACCCAGGAGTTTGTGATACACAGCCCCACGCTGACTGCCACCAAATGGTGGCCTGGAGACTTGGGACGGTCAGCCACCCATGCCCTGGTCCAGGCCCAGCTGATCTGCTCAGGAGCCAGGCGGGGCATGCACGCTTTTATTGTGCCAATCCGGAGTCTTCAGGACCACACCCCACTGCCAGGAATCATCATTGGGGACATCGGACCCAAGATGGACTTTGATCAAACAGACAATGGCTTCCTGCAGCTGAACCATGTGCGGGTCCCCAGGGAGAACATGCTGAGTCGCTTTGCACAGGTCTTGCCAGATGGCACCTACGTCAAACTCGGTACAGCACAGAGCAACTACCTTCCCATGGTGGTGGTGCGGGTGGAGCTGCTGTCAGGGGAGATCCTCCCTATACTGCAGAAGGCCTGTGTCATCGCCATGCGCTACTCGGTCATCCGCCGCCAATCCCGGCTCCGGCCCAGTGACCCAGAGGCAAAGGTCCTGGACTACCAGACACAACAGCAGAAACTCTTTCCTCAGCTGGCCATCAGTTATGCCTTCCATTTCCTGGCAGTCAGCCTCTTGGAGTTCTTCCAGCACTCCTACACTGCCATTCTGAACCAAGACTTCAGCTTCCTGCCTGAGCTCCACGCACTGAGCACGGGCATGAAGGCCATGATGTCAGAATTCTGCACCCAGGGAGCTGAGATGTGCCGCAGGGCCTGTGGCGGACATGGCTACTCAAAGCTGAGTGGCCTGCCATCACTGGTCACCAAATTGTCGGCCTCCTGTACCTACGAGGGTGAGAACACAGTGCTCTACCTGCAGGTGGCCAGGTTCCTGGTGAAGAGCTACCTGCAGACTCAGATGTCCCCTGGCTCCACGCCACAGAGATCTCTCTCTCCATCTGTCGCATATCTCACCGCACCTGACCTGGCCAGGTGTCCAGCCCAGAGGGCAGCCGACTTCCTCTGCCCGGAGCTCTACACCACGGCCTGGGCACATGTGGCAGTAAGGCTCATAAAGGACTCAGTGCAGCATTTACAGACCCTGACGCAATCCGGAGCTGACCAGCACGAGGCTTGGAACCAGACCACTGTCATACACCTCCAGGCTGCTAAGGTGCACTGCTACTATGTCACTGTGAAGGGTTTTACAGAAGCTCTGGAGAAACTAGAAAATGAACCAGCGATTCAGCAGGTGCTCAAGCGCCTCTGTGACCTCCATGCCATACATGGAATCTTGACTAACTCGGGTGACTTTCTCCATGACGCCTTCCTGTCTGGTGCCCAAGTGGACATGGCAAGAACAGCCTACCTGGACCTGCTCCGCCTGATCCGGAAGGATGCCATCCTGTTAACTGATGCTTTTGACTTCACCGATCAGTGTTTAAATTCAGCACTTGGCTGTTATGATGGAAACGTCTACGAACGCCTGTTCCAGTGGGCTCAGAAGTCACCAACCAATACTCAGGAGAACCCTGCCTATGAGGAATATATAAGACCACTTTTACAAAGTTGGAGATCCAAGCTATGAGCGGCCGC
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp

Do you need any help? Please get in touch and we’ll be happy to lend a hand.