cDNA Clone - ACOX2

Name: ACOX2
Price per aliquot: £110.00
Plasmid:
pSCB-ACOX2 Bam Not
Parent Plasmid:
pSC-B
View Parent Plasmid

Snapgene File | Genbank File
ATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCCACTGTGGAATTCGCCCTTAAGGGCGAATTCCACATTGGTCGCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCACCGCGGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATTAAATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGTTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCTCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGTTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCTTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATTAGTGTCCTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTTAATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTACAGTTAATTAAAGGGAACAAAAGCTGGCATGTACCGTTCGTATAGCATACATTATACGAACGGTACGCTCCAATTCGCCCTTTAATTAACTGTTCCAACTTTCACCATAATGAAATAAGATCACTACCGGGCGTATTTTTTGAGTTGTCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGGTGCCCTTAAACGCCTGGTTGCTACGCCTGAATAAGTGATAATAAGCGGATGAATGGCAGAAATTCGAAAGCAAATTCGACCCGGTCGTCGGTTCAGGGCAGGGTCGTTAAATAGCCGCTTATGTCTATTGCTGGTTTACCGGTTTATTGACTACCGGAAGCAGTGTGACCGTGTGCTTCTCAAATGCCTGAGGCCAGTTTGCTCAGGCTCTCCCCGTGGAGGTAATAATTGACGATATGATCCTTTTTTTCTGATCAAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTCCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT
DU Number:
DU41481
Genbank:
Species:
Human
Synonyms:
BCOX, BRCACOX, BRCOX, THCCox
Sequence of Insert:
View Sequence

GGATCCATGGGCAGCCCAGTGCACCGAGTGTCATTGGGGGATACCTGGAGCAGGCAAATGCACCCCGACATAGAGAGCGAGAGGTATATGCAGTCCTTTGACGTGGAACGGCTCACCAACATCCTTGATGGAGGTGCCCAGAACACTGCACTCCGCAGGAAAGTTGAGAGCATCATCCACAGTTACCCGGAGTTTAGCTGTAAGGACAATTATTTCATGACCCAGAATGAGCGTTATAAGGCTGCCATGCGGAGGGCATTCCACATCCGGTTGATAGCTCGGCGCCTGGGTTGGTTAGAAGATGGTCGTGAATTAGGCTACGCTTACAGAGCCCTTTCTGGAGACGTGGCCTTAAATATACACAGAGTCTTCGTGAGAGCCCTCAGGAGCCTGGGCTCAGAGGAGCAGATTGCCAAATGGGACCCACTCTGCAAAAACATCCAGATCATCGCAACGTATGCACAGACAGAGTTGGGACATGGGACATATCTTCAGGGCCTGGAGACTGAAGCCACCTATGACGCAGCCACCCAGGAGTTTGTGATACACAGCCCCACGCTGACTGCCACCAAATGGTGGCCTGGAGACTTGGGACGGTCAGCCACCCATGCCCTGGTCCAGGCCCAGCTGATCTGCTCAGGAGCCAGGCGGGGCATGCACGCTTTTATTGTGCCAATCCGGAGTCTTCAGGACCACACCCCACTGCCAGGAATCATCATTGGGGACATCGGACCCAAGATGGACTTTGATCAAACAGACAATGGCTTCCTGCAGCTGAACCATGTGCGGGTCCCCAGGGAGAACATGCTGAGTCGCTTTGCACAGGTCTTGCCAGATGGCACCTACGTCAAACTCGGTACAGCACAGAGCAACTACCTTCCCATGGTGGTGGTGCGGGTGGAGCTGCTGTCAGGGGAGATCCTCCCTATACTGCAGAAGGCCTGTGTCATCGCCATGCGCTACTCGGTCATCCGCCGCCAATCCCGGCTCCGGCCCAGTGACCCAGAGGCAAAGGTCCTGGACTACCAGACACAACAGCAGAAACTCTTTCCTCAGCTGGCCATCAGTTATGCCTTCCATTTCCTGGCAGTCAGCCTCTTGGAGTTCTTCCAGCACTCCTACACTGCCATTCTGAACCAAGACTTCAGCTTCCTGCCTGAGCTCCACGCACTGAGCACGGGCATGAAGGCCATGATGTCAGAATTCTGCACCCAGGGAGCTGAGATGTGCCGCAGGGCCTGTGGCGGACATGGCTACTCAAAGCTGAGTGGCCTGCCATCACTGGTCACCAAATTGTCGGCCTCCTGTACCTACGAGGGTGAGAACACAGTGCTCTACCTGCAGGTGGCCAGGTTCCTGGTGAAGAGCTACCTGCAGACTCAGATGTCCCCTGGCTCCACGCCACAGAGATCTCTCTCTCCATCTGTCGCATATCTCACCGCACCTGACCTGGCCAGGTGTCCAGCCCAGAGGGCAGCCGACTTCCTCTGCCCGGAGCTCTACACCACGGCCTGGGCACATGTGGCAGTAAGGCTCATAAAGGACTCAGTGCAGCATTTACAGACCCTGACGCAATCCGGAGCTGACCAGCACGAGGCTTGGAACCAGACCACTGTCATACACCTCCAGGCTGCTAAGGTGCACTGCTACTATGTCACTGTGAAGGGTTTTACAGAAGCTCTGGAGAAACTAGAAAATGAACCAGCGATTCAGCAGGTGCTCAAGCGCCTCTGTGACCTCCATGCCATACATGGAATCTTGACTAACTCGGGTGACTTTCTCCATGACGCCTTCCTGTCTGGTGCCCAAGTGGACATGGCAAGAACAGCCTACCTGGACCTGCTCCGCCTGATCCGGAAGGATGCCATCCTGTTAACTGATGCTTTTGACTTCACCGATCAGTGTTTAAATTCAGCACTTGGCTGTTATGATGGAAACGTCTACGAACGCCTGTTCCAGTGGGCTCAGAAGTCACCAACCAATACTCAGGAGAACCCTGCCTATGAGGAATATATAAGACCACTTTTACAAAGTTGGAGATCCAAGCTATGAGCGGCCGC
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp

Do you need any help? Please get in touch and we’ll be happy to lend a hand.