cDNA Clone - ACOX3

Name: ACOX3
Price per aliquot: £110.00
Plasmid:
pSCB-ACOX3 Bam Not
Parent Plasmid:
pSC-B
View Parent Plasmid

Snapgene File | Genbank File
ATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCCACTGTGGAATTCGCCCTTAAGGGCGAATTCCACATTGGTCGCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCACCGCGGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATTAAATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGTTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCTCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGTTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCTTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATTAGTGTCCTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTTAATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTACAGTTAATTAAAGGGAACAAAAGCTGGCATGTACCGTTCGTATAGCATACATTATACGAACGGTACGCTCCAATTCGCCCTTTAATTAACTGTTCCAACTTTCACCATAATGAAATAAGATCACTACCGGGCGTATTTTTTGAGTTGTCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGAGTACTGCGATGAGTGGCAGGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGGTGCCCTTAAACGCCTGGTTGCTACGCCTGAATAAGTGATAATAAGCGGATGAATGGCAGAAATTCGAAAGCAAATTCGACCCGGTCGTCGGTTCAGGGCAGGGTCGTTAAATAGCCGCTTATGTCTATTGCTGGTTTACCGGTTTATTGACTACCGGAAGCAGTGTGACCGTGTGCTTCTCAAATGCCTGAGGCCAGTTTGCTCAGGCTCTCCCCGTGGAGGTAATAATTGACGATATGATCCTTTTTTTCTGATCAAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTCCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT
DU Number:
DU41480
Genbank:
Species:
Human
Sequence of Insert:
View Sequence

GGATCCATGGCATCCACTGTGGAAGGAGGCGACACAGCTCTGCTCCCAGAATTCCCCAGGGGGCCCCTCGATGCCTACCGAGCAAGAGCGTCCTTCAGCTGGAAGGAGCTGGCGCTGTTCACGGAAGGGGAGGGCATGCTCCGCTTTAAGAAAACCATCTTCTCAGCTCTTGAGAATGACCCTCTTTTCGCTCGTTCCCCTGGAGCCGATCTGTCCTTGGAGAAGTATCGCGAGCTGAACTTCCTTCGATGCAAGCGGATCTTCGAGTATGACTTCCTCAGTGTCGAAGACATGTTCAAGAGCCCTCTGAAGGTCCCCGCCTTGATTCAGTGCCTGGGCATGTATGACTCTTCTCTGGCTGCCAAGTACCTCCTCCATAGCTTGGTTTTTGGATCAGCAGTTTACAGTTCTGGTTCTGAAAGACATCTCACATATATTCAAAAGATCTTCAGGATGGAGATTTTTGGATGTTTTGCTCTGACCGAATTAAGCCACGGCAGTAATACCAAGGCCATTCGCACAACTGCCCACTACGATCCTGCCACTGAGGAATTCATCATACATTCCCCTGATTTCGAAGCTGCCAAGTTTTGGGTTGGCAACATGGGCAAGACAGCCACTCACGCGGTGGTGTTTGCTAAGCTGTGTGTGCCAGGGGACCAGTGCCATGGGCTGCATCCCTTTATCGTGCAGATCCGGGACCCGAAGACCCTTCTTCCCATGCCTGGAGTGATGGTTGGCGACATAGGAAAAAAACTCGGGCAGAACGGTCTGGATAATGGTTTCGCCATGTTCCACAAGGTCAGAGTTCCTCGCCAGAGCCTTCTGAACCGGATGGGAGACGTCACCCCCGAGGGCACCTATGTCAGCCCCTTTAAGGACGTCAGGCAGCGCTTTGGAGCGTCCCTGGGGAGCCTGTCCTCGGGCCGGGTCTCCATCGTGAGCCTGGCCATCCTTAACCTAAAGCTGGCCGTGGCCATCGCTCTTCGCTTCTCAGCCACTCGGCGTCAGTTTGGACCCACAGAGGAGGAGGAAATACCAGTGCTTGAGTATCCAATGCAGCAATGGCGCTTGCTTCCATATCTGGCAGCTGTCTACGCCTTAGACCATTTCTCCAAGTCGCTCTTCCTGGACCTGGTGGAGCTCCAGCGAGGACTTGCATCGGGAGACCGCAGCGCCAGACAGGCAGAGCTTGGACGTGAGATCCACGCCCTGGCATCGGCCAGCAAGCCCCTGGCCTCGTGGACCACCCAGCAAGGAATTCAGGAATGCCGGGAGGCGTGTGGAGGACACGGCTATCTGGCCATGAACCGGTTGGGTGTCCTTAGAGATGACAACGATCCCAACTGCACATACGAAGGTGACAACAACATCCTGCTGCAGCAGACAAGCAACTATTTGCTGGGTCTCCTGGCACACCAGGTCCACGATGGAGCTTGCTTCCGCAGTCCGCTGAAGTCAGTGGACTTTCTGGACGCCTATCCCGGCATCCTTGACCAGAAGTTTGAGGTCTCCAGTGTTGCCGACTGCTTGGACTCTGCAGTCGCCCTGGCAGCATACAAGTGGCTGGTTTGCTACCTGCTCCGAGAGACTTATCAAAAATTAAACCAAGAGAAAAGATCAGGAAGCAGTGACTTTGAAGCAAGGAACAAATGCCAGGTGTCCCACGGCCGTCCGTTGGCGCTGGCCTTCGTGGAGCTCACGGTGGTCCAGAGGTTCCACGAGCACGTGCACCAGCCTTCCGTGCCGCCCTCGCTGCGGGCCGTGCTGGGGCGGCTCAGTGCTCTGTACGCCCTGTGGTCCCTGAGCCGCCACGCGGCCCTGCTCTACCGAGCTGAAAGACGATGCAGTTGCCCTGGTAGACGTGATCGCTCCTCCTGAGCGGCCGC
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp

Do you need any help? Please get in touch and we’ll be happy to lend a hand.