cDNA Clone - ZNRF2 (genomic)

Name: ZNRF2 (genomic)
Price per aliquot: £110.00
Plasmid:
pAAV + SEPT + ZNRF2 targeting construct
Parent Plasmid:
pAAV MCS
View Parent Plasmid

Snapgene File | Genbank File
CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCACGCGTGGAGCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGTCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGATTCGAATCCCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACGTAAGTACCGCCTATAGAGTCTATAGGCCCACAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTGGGATTCGAACATCGATTGAATTCCCCGGGGATCCTCTAGAGTCGACCTGCAGAAGCTTGCCTCGAGCAGCGCTGCTCGAGAGATCTACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTCTGATTTTGTAGGTAACCACGTGCGGACCGAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGT
DU Number:
DU40015
Species:
Human
Sequence of Insert:
View Sequence

gcggccgcCATTTTTATATGTGCAATTTAATAGCATTTAAGACATTCACAACCCCCATCTTTATCTGGTTCTAAACACTTCATCGCCCCAAAAGAAAACCTCTGGTGTGATTCCACTTACATGAGGTAGCTAAAATACTCAAACTCATAGAAGCAGAGAGTAGACTAGTGGTGGCCAGGGGCTGGGCGGGGGGAAGGGGAGTGGTGGATTAATGGGTATAACATTTTAGTTATGCACGATGAGTAAGTTCTAGACATCTGCCATACAACATAGTGCCTACAGTTGACAATACTATaTTGTACACTTGAAGATTTGTTAAGAGGATAGAGCATATGTTAGTCTTACCACAATAAAATAAAGTTTTTAAAAGGGGAAAAAACGGGTCAGGCGTGGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGGGTGGATCACGAGGTCAGGAGTTCGAGACCAGCCCGGCCAACATGGTGAAACCCCGTCTCTACTAAAAATACAAAAACTAGCCAGGCGTGGTGGTGGGCGCCTGTAATCCTAGCTACTCGGGAGGCTGAGACAGGAAAATCACTTGAACCCAGGAGGCGGGGGTTGCAGTGAGCCGAGATAGTGCCACTGCACTCCAGTCTGGGTGACAGAGTGAGACTCCATCTCAAATAAAAGCGGGGTGGTGGGGGGGGAGAAAACCCCCTACCCATTAAGCAGTCAtTCCCCATATCCCTCTGTCCCCAATACTGATCTCCTTTCCCTCTCTATGGATGTATCTATTCTGGACATTTCATATAAATGGGTTCATACAATAGGTGGTTTCTTTTACTTTGTGTAGTATTTTTGACGTTTATCCATGTTTTAGCATGTGGTGGTTCTTCCTTTTCTTGGCTTAGTAATATTCCATTGTGTGGATACATCATCTTTTGTTTATCCGTTGCGCAGTTTGTAGACACTGGGTTGTTTCCACCTTTGGGCTGTTGTGAACAATGCTGCTGTGAACCTCCGTGCACAAGGATTTTCTTGGGGACCTGTTTCTTCCTCTCATTCTTGCCTCCTACCACTCTACCCATTACCATATTTTTCCAAACCAGACATCAGCACACTGGCTACGTGTGTGTTTAGGAAAGCATCTGTGGAGGGAAACAGCTTGCCTCATGCTGCCCCTGCTTCCTGTCTACCCTTCTCCAAGCCTTTTTCGTCCGCTGTCACCgagctccaccgcggtggcggccgctctagaactagtggatccataacttcgtatagcatacattatacgaagttatggaattaattcgctgtctgcgagggccagctgttggggtgagtactccctctcaaaagcgggcatgacttctgcgctaagattgtcagtttccaaaaacgaggaggatttgatattcacctggcccgcggtgatgcctttgagggtggccgcgtccatctggtcagaaaagacaatctttttgttgtcaagcttgaggtgtggcaggcttgagatctggccatacacttgagtgacaatgacatccactttgcctttctctccacaggtgtccactcccaggtccaactgcaggtcgagcgtcgagaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataagcttgccacaaccatggctgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgggggatccagacatgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagttaacaacaacaattgcattcattttatgtttcaggttcagggggaggtgtgggaggttttttctagggggccccggcgaggccgggatgagttgggaataacttcgtatagcatacattatacgaagttatccaaattttaaggtaccactgtgcatatgtatgaattcGGGAGCTGATGGGGAGACCCGTAGAGCCTCACAGGTTGGAGGAGCTTCGGATCCCACTGGGAAGGTTGGTTCTCCGTCTGTCTCCCTGCCTCTTCTTCCTCTACGGGTCCCTCTGCTCCACAGGGGTAGAACATCAATCTGTGCGAGGAAGGCCAGGCGGAGGGTGTACCCACTGCCTTGCACTGGCCTTCTCCCTAGAGGGCCGGGAGGCAGGAAGAGCCATTTCCTGTGGGGCCACAGCACTGGGCACAGTTAAAAGTAGCAGGGCCCAGATATGCCTTGGGACTCCAGTGTGAGCCTCGTCCTTGTTTCCAGCTGGAAGGAAGGCACCCTCTTGCCCAAGACAGGACACTGTGCTGCCTGGGGCCAGCACCTGcTGAATCCTCGAGCCCAGAGCTTCTTCCTGACACTCAGGCCTTTCAAAGCCTGACTCTCAGGGCCACTGCTGCACAGGGTGACAACCGGGCATGGCACGCAGTGTGGCTGGTGCAGAGGAGGCTTAAGGCTGGCCTGGGAGAGATTCTTGGTCTAGCTCCCAGCACGGAGCCTTGCTTGTGTCCCAGGGCGGCACTAACCAGAACCAGAAAAGGAAATCTTTGGCCCTCGGGGAGAATTATGCCAATTATCTGTCTGGTTCCTGTCTTTGAAAATGCCCAGATGTTGGTTTACAAATCAGGAAGCTGTCTTGGGGCAATCTCTGTTCCCTCTTTGATGCAGAGAGCCTTTCTCTGTAAACACTGGAGAGCAGGGCTTCACTGTCTGGCTCCCCTCCCGCCTCTTGCAGGAAGGACTAGATGCTGCTGATCAGCTGATCATGGCTGAGCCGGGTAGAGCTTGGGGCTCTCCTAAGAGGTCACCCACTGGGAGGGAGCTTCACAGCTGTTCTTTTGACCCAGGAAGGAGCTCTTTCAGGACTGTGGCACCCAGAGCCGTGGCCCTCCTGCCATGCCATTGTTCCCACTTCCCTGCCCTTGGGAGTCTTGGAGACAGCTGACTAGCTGCCCTGAGGGGTCCACCGCTCTCACCTTCTCACTGGTGGCTGCTGCCATTCTCCTGGGCTCTGCACAGAAAGCTTTGGTCCTTCTGAAAGCCACTCTGCCCCTTCCTGCAGCACCAGATCCCCCTGAGCCGGTACTGCTGCCTCCACCTGGGCCAAGACTAGTCgcggccgc
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp
Comments:
For knock-out of ZNRF2 using Bunz method. All ZNRF2 plasmids MUST be grown at 30 degrees C or less to prevent recombination.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.