cDNA Clone - 14-3-3 sigma

Name: 14-3-3 sigma
Price per aliquot: £110.00
GST-14-3-3 sigma
pEBG6P-1 14-3-3 sigma
Parent Plasmid:
View Parent Plasmid

Snapgene File | Genbank File
DU Number:
Sequence of Insert:
View Sequence

ggatccatggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctggagggtgctgtccagtattgagcagaaaagcaacgaggagggctcggaggagaaggggcccgaggtgcgtgagtaccgggagaaggtggagactgagctccagggcgtgtgcgacaccgtgctg ggcctgctggacagccacctcatcaaggaggccggggacgccgagagccgggtcttctacctgaagatgaagggtgactactaccgctacctggccgaggtggccaccggtgacgacaagaagcgcatcattgactcagcccggtcagcctaccaggaggccatggacatcagcaagaaggagatgccgcccaccaaccccatccgcctgggcctggccctgaacttttccgtcttccactacgagatcgccaacagccccgaggaggccatctctctggccaagaccactttcgacgaggccatggctgatctgcacaccctcagcgaggactcctacaaagacagcaccctcatcatgcagctgctgcgagacaacctgacactgtggacggccgacaacgccggggaagaggggggcgaggctccccaggagccccagagctgagcggccgc
Amino Acid Sequence:
View Sequence

Mammalian expression plasmid to express 14-3-3 sigma with N-terminal GST (contains preScission protease site) Estimated MW of expressed protein : 55189 Daltons

Do you need any help? Please get in touch and we’ll be happy to lend a hand.