cDNA Clone - SNRK

Name: SNRK
Price per aliquot: £110.00
Expressed:
6His-SNRK
Plasmid:
pFastBac.HTa SNRK
Parent Plasmid:
pFastBac HTb
View Parent Plasmid

Snapgene File | Genbank File
GACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCAGACCAGCCGCGTAACCTGGCAAAATCGGTTACGGTTGAGTAATAAATGGATGCCCTGCGTAAGCGGGTGTGGGCGGACAATAAAGTCTTAAACTGAACAAAATAGATCTAAACTATGACAATAAAGTCTTAAACTAGACAGAATAGTTGTAAACTGAAATCAGTCCAGTTATGCTGTGAAAAAGCATACTGGACTTTTGTTATGGCTAAAGCAAACTCTTCATTTTCTGAAGTGCAAATTGCCCGTCGTATTAAAGAGGGGCGTGGCCAAGGGCATGGTAAAGACTATATTCGCGGCGTTGTGACAATTTACCGAACAACTCCGCGGCCGGGAAGCCGATCTCGGCTTGAACGAATTGTTAGGTGGCGGTACTTGGGTCGATATCAAAGTGCATCACTTCTTCCCGTATGCCCAACTTTGTATAGAGAGCCACTGCGGGATCGTCACCGTAATCTGCTTGCACGTAGATCACATAAGCACCAAGCGCGTTGGCCTCATGCTTGAGGAGATTGATGAGCGCGGTGGCAATGCCCTGCCTCCGGTGCTCGCCGGAGACTGCGAGATCATAGATATAGATCTCACTACGCGGCTGCTCAAACCTGGGCAGAACGTAAGCCGCGAGAGCGCCAACAACCGCTTCTTGGTCGAAGGCAGCAAGCGCGATGAATGTCTTACTACGGAGCAAGTTCCCGAGGTAATCGGAGTCCGGCTGATGTTGGGAGTAGGTGGCTACGTCTCCGAACTCACGACCGAAAAGATCAAGAGCAGCCCGCATGGATTTGACTTGGTCAGGGCCGAGCCTACATGTGCGAATGATGCCCATACTTGAGCCACCTAACTTTGTTTTAGGGCGACTGCCCTGCTGCGTAACATCGTTGCTGCTGCGTAACATCGTTGCTGCTCCATAACATCAAACATCGACCCACGGCGTAACGCGCTTGCTGCTTGGATGCCCGAGGCATAGACTGTACAAAAAAACAGTCATAACAAGCCATGAAAACCGCCACTGCGCCGTTACCACCGCTGCGTTCGGTCAAGGTTCTGGACCAGTTGCGTGAGCGCATACGCTACTTGCATTACAGTTTACGAACCGAACAGGCTTATGTCAACTGGGTTCGTGCCTTCATCCGTTTCCACGGTGTGCGTCACCCGGCAACCTTGGGCAGCAGCGAAGTCGAGGCATTTCTGTCCTGGCTGGCGAACGAGCGCAAGGTTTCGGTCTCCACGCATCGTCAGGCATTGGCGGCCTTGCTGTTCTTCTACGGCAAGGTGCTGTGCACGGATCTGCCCTGGCTTCAGGAGATCGGAAGACCTCGGCCGTCGCGGCGCTTGCCGGTGGTGCTGACCCCGGATGAAGTGGTTCGCATCCTCGGTTTTCTGGAAGGCGAGCATCGTTTGTTCGCCCAGGACTCTAGCTATAGTTCTAGTGGTTGGCTACGTATACTCCGGAATATTAATAGATCATGGAGATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATTCCGGATTATTCATACCGTCCCACCATCGGGCGCGGATCTCGGTCCGAAACCATGTCGTACTACCATCACCATCACCATCACGATTACGATATCCCAACGACCGAAAACCTGTATTTTCAGGGCGCCATGGGATCCGGAATTCAAAGGCCTACGTCGACGAGCTCACTAGTCGCGGCCGCTTTCGAATCTAGAGCCTGCAGTCTCGAGGCATGCGGTACCAAGCTTGTCGAGAAGTACTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCTGATCACTGATATCGCCTAGGAGATCCGAACCAGATAAGTGAAATCTAGTTCCAAACTATTTTGTCATTTTTAATTTTCGTATTAGCTTACGACGCTACACCCAGTTCCCATCTATTTTGTCACTCTTCCCTAAATAATCCTTAAAAACTCCATTTCCACCCCTCCCAGTTCCCAACTATTTTGTCCGCCCACAGCGGGGCATTTTTCTTCCTGTTATGTTTTTAATCAAACATCCTGCCAACTCCATGTGACAAACCGTCATCTTCGGCTACTTTTTCTCTGTCACAGAATGAAAATTTTTCTGTCATCTCTTCGTTATTAATGTTTGTAATTGACTGAATATCAACGCTTATTTGCAGCCTGAATGGCGAATGG
DU Number:
DU1369
Genbank:
Species:
Human
Sequence of Insert:
View Sequence

gaattcGCAGGATTTAAGCGAGGGTATGATGGAAAGATTGCTGGATTATATGATCTGGATAAAACCTTGGGTCGAGGCCATTTTGCCGTGGTTAAACTTGCCAGGCATGTCTTTACGGGTGAAAAGGTGGCAGTAAAAGTTATTGACAAGACAAAACTGGACACTCTAGCTACTGGTCATCTTTTCCAGGAAGTGAGATGCATGAAACTAGTGCAGCATCCTAACATCGTCCGCCTTTATGAAGTTATTGACACCCAGACCAAACTATATCTTATTCTAGAACTTGGGGATGAAGGAGATATGTTTGATTATATAATGAAACATGAGGAGGGTCTTAATGAAGACTTGCCCAAGAAGTATTTTGCTCAGATAGTTCATGCTATATCTTATTGCCATAAACTCCATGTGGTTCACAGAGACTTAAAACCAGAGAATGTAGTCTTCTTTGAAAAACAAGGTCTTGTAAAGTTGACAGACTTTGGGTTCAGCAACAAATTTCAACCAGGGAAGAAGCTCACTACAAGCTGTGGATCTCTTGCATATTCCGCTCCAGAAATTCTGCTTGGTGATGAGTATGATGCACCTGCAGTAGATATTTGGAGTCTGGGAGTGATCCTTTTCATGTTGGTGTGTGGGCAGCCGCCCTTTCAAGAAGCCAATGACAGTGAAACACTGACAATGATCATGGATTGCAAATATACAGTACCATCCCATGTGTCTAAAGAGTGTAAAGACCTAATCACACGGATGCTACAGAGAGATCCCAAGAGAAGGGCTTCTTTAGAAGAGATTGAAAATCATCCTTGGCTTCAGGGAGTGGACCCTTCACCAGCTACAAAGTATAACATTCCCCTTGTGTCATACAAAAATCTCTCGGAAGAGGAGCACAACAGCATCATTCAGCGCATGGTGCTTGGGGACATAGCGGATCGAGACGCCATTGTAGAAGCCCTGGAAACCAACAGGTATAACCATATCACAGCCACATACTTCCTGCTGGCTGAAAGGATCCTGAGAGAAAAGCAAGAGAAAGAAATACAGACCAGATCTGCAAGCCCGAGCAATATCAAGGCCCAGTTTAGGCAGTCATGGCCAACCAAAATTGATGTACCCCAGGACCTTGAGGATGACCTCACGGCCACTCCTTTGTCCCACGCGACTGTCCCTCAGTCTCCTGCTCGGGCTGCTGACAGTGTCCTCAATGGCCACAGGAGCAAAGGCCTGTGTGACTCAGCTAAGAAAGATGACCTCCCTGAGTTGGCTGGACCAGCACTCTCTACGGTGCCACCCGCAAGCTTAAAACCCACAGCCAGTGGGCGGAAGTGTCTGTTCAGGGTGGAAGAAGATGAAGAGGAAGATGAGGAGGACAAGAAACCCATGTCCCTCTCAACACAAGTGGTTTTGCGCCGGAAGCCATCTGTAACCAACCGCCTGACATCCAGGAAGAGTGCGCCCGTCCTCAACCAGATCTTTGAGGAAGGGGAATCTGATGATGAGTTTGACATGGATGAGAATCTGCCTCCCAAGTTGAGCAGGTTAAAGATGAATATAGCTTCTCCAGGTACAGTTCACAAACGCTACCACCGGAGGAAAAGTCAGGGCCGGGGCTCCAGCTGCAGTAGTTCGGAGACCAGTGATGATGATTCTGAAAGCCGGCGGCGGCTCGATAAAGATAGCGGGTTCACCTACTCCTGGCACCGACGGGATAGCAGCGAGGGGCCCCCTGGCAGTGAGGGGGATGGCGGGGGCCAGAGCAAGCCGAGCAATGCCAGTGGAGGGGTGGACAAGGCCAGCCCCAGTGAGAACAATGCTGGTGGGGGCAGTCCCTCCAGCGGCTCGGGTGGCAACCCCACCAATACATCGGGTACCACACGCCGCTGTGCCGGCCCCAGCAACTCCATGCAGCTGGCCTCTCGCAGTGCTGGGGAGCTCGTTGAGAGCCTCAAACTCATGAGCCTCTGCCTCGGCTCCCAGCTTCATGGGAGCACCAAGTACATTATTGATCCACAGAATGGCTTGTCATTTTCCAGTGTGAAAGTCCAAGAGAAATCTACGTGGAAAATGTGCATTAGCTCCACAGGGAATGCAGGGCAGGTCCCTGCAGTGGGCGGCATAAAGTTTTTCTCTGACCACATGGCAGATACCACCACTGAATTGGAACGGATAAAGAGCAAGAACCTGAAAAATAACGTGCTGCAGCTACCTCTGTGCGAAAAGACCATCTCTGTGAACATCCAGCGGAACCCTAAGGAGGGGCTGCTGTGCGCATCCAGCCCAGCCAGCTGTTGCCATGTCATCTGAgcggccgc
Amino Acid Sequence:
View Sequence

MSYYHHHHHHDYDIPTTENLYFQGAMDPEFAGFKRGYDGKIAGLYDLDKTLGRGHFAVVKLARHVFTGEKVAVKVIDKTKLDTLATGHLFQEVRCMKLVQHPNIVRLYEVIDTQTKLYLILELGDEGDMFDYIMKHEEGLNEDLPKKYFAQIVHAISYCHKLHVVHRDLKPENVVFFEKQGLVKLTDFGFSNKFQPGKKLTTSCGSLAYSAPEILLGDEYDAPAVDIWSLGVILFMLVCGQPPFQEANDSETLTMIMDCKYTVPSHVSKECKDLITRMLQRDPKRRASLEEIENHPWLQGVDPSPATKYNIPLVSYKNLSEEEHNSIIQRMVLGDIADRDAIVEALETNRYNHITATYFLLAERILREKQEKEIQTRSASPSNIKAQFRQSWPTKIDVPQDLEDDLTATPLSHATVPQSPARAADSVLNGHRSKGLCDSAKKDDLPELAGPALSTVPPASLKPTASGRKCLFRVEEDEEEDEEDKKPMSLSTQVVLRRKPSVTNRLTSRKSAPVLNQIFEEGESDDEFDMDENLPPKLSRLKMNIASPGTVHKRYHRRKSQGRGSSCSSSETSDDDSESRRRLDKDSGFTYSWHRRDSSEGPPGSEGDGGGQSKPSNASGGVDKASPSENNAGGGSPSSGSGGNPTNTSGTTRRCAGPSNSMQLASRSAGELVESLKLMSLCLGSQLHGSTKYIIDPQNGLSFSSVKVQEKSTWKMCISSTGNAGQVPAVGGIKFFSDHMADTTTELERIKSKNLKNNVLQLPLCEKTISVNIQRNPKEGLLCASSPASCCHVI*
Antibiotic:
Amp
Comments:
Baculovirus expression plasmid with N-terminal 6His tag. Changes to NM_017719 CDS sequence: a290g (E97G)* c346g (P116A)* t1488c (silent in D496)* g1758a (silent in P586) * changes also present in SNRK sequence in Sugen database.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.