cDNA Clone - SNRK

Name: SNRK
Price per aliquot: £110.00
Expressed:
GFP-TAP HA-SNRK
Plasmid:
pGFP-TAP-BN HA.SNRK
Parent Plasmid:
pGFP TAP BN
View Parent Plasmid

Snapgene File | Genbank File
TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCG CCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGT AAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTA CATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGA TAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTA ACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTA CCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCG TGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGAC CACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAG CGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCG ACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAA GGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTG CCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGA TCACTCTCGGCATGGACGAGCTGTACAAGTCCGGCCGGACTCAGATCTCGAGCTCAAGCTTCGATATCGCCCTTGCCACCATGGACACAAGTGCCCACGA TGAAGCCGTAGACAACAAATTCAACAAAGAACAACAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTAAACGAAGAACAACGAAACGCCTTCATC CAAAGTTTAAAAGATGACCCAAGCCAAAGCGCTAACCTTTTAGCAGAAGCTAAAAAGCTAAATGATGCTCAGGCGCCGAAAGTAGACAACAAATTCAACA AAGAACGACAAAACGCGTTCTATGAGATCTTACATTTACCTAACTTAAACGAAGAACAACGAAACGCCTTCATCCAAAGTTTAAAAGATGACCCAAGCCA AAGCGCTAACCTTTTAGCAGAAGCTAAAAAGCTAAATGATGCTCAGGCGCCGAAAGTAGACGCGAGTTGGTCAGCGGGTGCTAGCGAGAACTTGTACTTC CAGGGCGGAAGATCGATGGAAAAGAGAAGATGGAAAAAGAATTTCATAGCCGTCTCAGCAGCCAACCGCTTTAAGAAAATCTCATCCTCCGGGGCACTTG ATTATGATATTCCAACTGCTCTGGAAGTTCTGTTCCAGGGGCCCCTGGGATCCAGATCTGGTACCGCGGCCGCAAGGGCGAATTCTGCAGTCGACGGTAC CGCGGGCCCGGTATCGACCGGATCTAGATAACTGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCC CTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAA ATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTAACGCGTAAATTGTAAGCGTTAATATTTTGTTAAAATTCG CGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGT TGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCA TCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGA ACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCT TAATGCGCCGCTACAGGGCGCGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCG CTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTCCTGAGGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTG TGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGC AGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTC CGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCT AGGCTTTTGCAAAGATCGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAG GCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACC GACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCA CTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGA TGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGT CTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCG TCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTA TCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCG CAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGA TTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAG TTCTTCGCCCACCCTAGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGC ACGGTGTTGGGTCGTTTGTTCATAAACGCGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGT TTCTTCCTTTTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCCTCAGGTTACTCA TATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGT TTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACC ACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTT CTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCG ATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGA GCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGC AGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGAT TTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCATGCAT
DU Number:
DU1321
Genbank:
Species:
Human
Sequence of Insert:
View Sequence

GcggccgcCATGTACCCATACGATGTGCCAGATTACGCCGCAGGATTTAAGCGAGGGTATGATGGAAAGATTGCTGGATTATATGATCTGGATAAAACCTTGGGTCGAGGCCATTTTGCCGTGGTTAAACTTGCCAGGCATGTCTTTACGGGTGAAAAGGTGGCAGTAAAAGTTATTGACAAGACAAAACTGGACACTCTAGCTACTGGTCATCTTTTCCAGGAAGTGAGATGCATGAAACTAGTGCAGCATCCTAACATCGTCCGCCTTTATGAAGTTATTGACACCCAGACCAAACTATATCTTATTCTAGAACTTGGGGATGGAGGAGATATGTTTGATTATATAATGAAACATGAGGAGGGTCTTAATGAAGACTTGGCCAAGAAGTATTTTGCTCAGATAGTTCATGCTATATCTTATTGCCATAAACTCCATGTGGTTCACAGAGACTTAAAACCAGAGAATGTAGTCTTCTTTGAAAAACAAGGTCTTGTAAAGTTGACAGACTTTGGGTTCAGCAACAAATTTCAACCAGGGAAGAAGCTCACTACAAGCTGTGGATCTCTTGCATATTCCGCTCCAGAAATTCTGCTTGGTGATGAGTATGATGCACCTGCAGTAGATATTTGGAGTCTGGGAGTGATCCTTTTCATGTTGGTGTGTGGGCAGCCGCCCTTTCAAGAAGCCAATGACAGTGAAACACTGACAATGATCATGGATTGCAAATATACAGTACCATCCCATGTGTCTAAAGAGTGTAAAGACCTAATCACACGGATGCTACAGAGAGATCCCAAGAGAAGGGCTTCTTTAGAAGAGATTGAAAATCATCCTTGGCTTCAGGGAGTGGACCCTTCACCAGCTACAAAGTATAACATTCCCCTTGTGTCATACAAAAATCTCTCGGAAGAGGAGCACAACAGCATCATTCAGCGCATGGTGCTTGGGGACATAGCGGATCGAGACGCCATTGTAGAAGCCCTGGAAACCAACAGGTATAACCATATCACAGCCACATACTTCCTGCTGGCTGAAAGGATCCTGAGAGAAAAGCAAGAGAAAGAAATACAGACCAGATCTGCAAGCCCGAGCAATATCAAGGCCCAGTTTAGGCAGTCATGGCCAACCAAAATTGATGTACCCCAGGACCTTGAGGATGACCTCACGGCCACTCCTTTGTCCCACGCGACTGTCCCTCAGTCTCCTGCTCGGGCTGCTGACAGTGTCCTCAATGGCCACAGGAGCAAAGGCCTGTGTGACTCAGCTAAGAAAGATGACCTCCCTGAGTTGGCTGGACCAGCACTCTCTACGGTGCCACCCGCAAGCTTAAAACCCACAGCCAGTGGGCGGAAGTGTCTGTTCAGGGTGGAAGAA GATGAAGAGGAAGATGAGGAGGACAAGAAACCCATGTCCCTCTCAACACA AGTGGTTTTGCGCCGGAAGCCATCTGTAACCAACCGCCTGACATCCAGGA AGAGTGCGCCCGTCCTCAACCAGATCTTTGAGGAAGGGGAATCTGACGAT GAGTTTGACATGGATGAGAATCTGCCTCCCAAGTTGAGCAGGTTAAAGAT GAATATAGCTTCTCCAGGTACAGTTCACAAACGCTACCACCGGAGGAAAA GTCAGGGCCGGGGCTCCAGCTGCAGTAGTTCGGAGACCAGTGATGATGAT TCTGAAAGCCGGCGGCGGCTCGATAAAGATAGCGGGTTCACCTACTCCTG GCACCGACGGGATAGCAGCGAGGGGCCCCCTGGCAGTGAGGGGGATGGCG GGGGCCAGAGCAAGCCAAGCAATGCCAGTGGAGGGGTGGACAAGGCCAGC CCCAGTGAGAACAATGCTGGTGGGGGCAGTCCCTCCAGCGGCTCGGGTGG CAACCCCACCAATACATCGGGTACCACACGCCGCTGTGCCGGCCCCAGCA ACTCCATGCAGCTGGCCTCTCGCAGTGCTGGGGAGCTCGTTGAGAGCCTC AAACTCATGAGCCTCTGCCTCGGCTCCCAGCTTCATGGGAGCACCAAGTA CATTATTGATCCACAGAATGGCTTGTCATTTTCCAGTGTGAAAGTCCAAG AGAAATCTACGTGGAAAATGTGCATTAGCTCCACAGGGAATGCAGGGCAG GTCCCTGCAGTGGGCGGCATAAAGTTTTTCTCTGACCACATGGCAGATAC CACCACTGAATTGGAACGGATAAAGAGCAAGAACCTGAAAAATAACGTGC TGCAGCTACCTCTGTGCGAAAAGACCATCTCTGTGAACATCCAGCGGAAC CCTAAGGAGGGGCTGCTGTGCGCATCCAGCCCAGCCAGCTGTTGCCATGT CATCTGAgcggccgc
Amino Acid Sequence:
View Sequence

MVSKGEELFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKFICTTGKLPVPWPTLVTTLTYGVQCFSRYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNYNSHNVYIMADKQKNGIKVNFKIRHNIEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSALSKDPNEKRDHMVLLEFVTAAGITLGMDELYKSGRTQISSSSFDIALATMDTSAHDEAVDNKFNKEQQNAFYEILHLPNLNEEQRNAFIQSLKDDPSQSANLLAEAKKLNDAQAPKVDNKFNKERQNAFYEILHLPNLNEEQRNAFIQSLKDDPSQSANLLAEAKKLNDAQAPKVDASWSAGASENLYFQGGRSMEKRRWKKNFIAVSAANRFKKISSSGALDYDIPTALEVLFQGPLGSRSGTAAAMYPYDVPDYAAGFKRGYDGKIAGLYDLDKTLGRGHFAVVKLARHVFTGEKVAVKVIDKTKLDTLATGHLFQEVRCMKLVQHPNIVRLYEVIDTQTKLYLILELGDGGDMFDYIMKHEEGLNEDLAKKYFAQIVHAISYCHKLHVVHRDLKPENVVFFEKQGLVKLTDFGFSNKFQPGKKLTTSCGSLAYSAPEILLGDEYDAPAVDIWSLGVILFMLVCGQPPFQEANDSETLTMIMDCKYTVPSHVSKECKDLITRMLQRDPKRRASLEEIENHPWLQGVDPSPATKYNIPLVSYKNLSEEEHNSIIQRMVLGDIADRDAIVEALETNRYNHITATYFLLAERILREKQEKEIQTRSASPSNIKAQFRQSWPTKIDVPQDLEDDLTATPLSHATVPQSPARAADSVLNGHRSKGLCDSAKKDDLPELAGPALSTVPPASLKPTASGRKCLFRVEEDEEEDEEDKKPMSLSTQVVLRRKPSVTNRLTSRKSAPVLNQIFEEGESDDEFDMDENLPPKLSRLKMNIASPGTVHKRYHRRKSQGRGSSCSSSETSDDDSESRRRLDKDSGFTYSWHRRDSSEGPPGSEGDGGGQSKPSNASGGVDKASPSENNAGGGSPSSGSGGNPTNTSGTTRRCAGPSNSMQLASRSAGELVESLKLMSLCLGSQLHGSTKYIIDPQNGLSFSSVKVQEKSTWKMCISSTGNAGQVPAVGGIKFFSDHMADTTTELERIKSKNLKNNVLQLPLCEKTISVNIQRNPKEGLLCASSPASCCHVI*
Antibiotic:
Kan
Comments:
Changes to NM_017719 CDS sequence: a290g (E97G)* c346g (P116A)* t1488c (silent in D496)* g1758a (silent in P586) * changes also present in SNRK sequence in Sugen database

Do you need any help? Please get in touch and we’ll be happy to lend a hand.