cDNA Clone - SOS2

Name: SOS2
Price per aliquot: £110.00
Expressed:
GST-SOS2 (son of sevenless-2)
Plasmid:
pEBG6P-SOS2 (son of sevenless-2)
Parent Plasmid:
pEBG6P
View Parent Plasmid

Snapgene File | Genbank File
AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTTTGCAAAGATGGATAAAGTTTTAAACAGAGAGGAATCTTTGCAGCTAATGGACCTTCTAGGTCTTGAAAGGAGTGGGAATTGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACGCCCCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAGGAATTCTCTAGAGATCCCTCGACCTCGAGATCCATTGTGCTGGATCTACAATGGCCCCTATACTAGGTTATTGGAAAATTAAGGGCCTTGTGCAACCCACTCGACTTCTTTTGGAATATCTTGAAGAAAAATATGAAGAGCATTTGTATGAGCGCGATGAAGGTGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCAATCTTCCTTATTATATTGATGGTGATGTTAAATTAACACAGTCTATGGCCATCATACGTTATATAGCTGACAAGCACAACATGTTGGGTGGTTGTCCAAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGAGCGGTTTTGGATATTAGATACGGTGTTTCGAGAATTGCATATAGTAAAGACTTTGAAACTCTCAAAGTTGATTTTCTTAGCAAGCTACCTGAAATGCTGAAAATGTTCGAAGATCGTTTATGTCATAAAACATATTTAAATGGTGATCATGTAACCCATCCTGACTTCATGTTGTATGACGCTCTTGATGTTGTTTTATACATGGACCCAATGTGCCTGGATGCGTTCCCAAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCCACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCATGGCCTTTGCAGGGCTGGCAAGCCACGTTTGGTGGTGGCGACCATCCTCCAAAATCGGATCTGGTTCCGCGTGGATCTCTGGAAGTTCTGTTCCAGGGGCCCCTGGGATCCACTAGTGGTACCATCGATGCGGCCGCGACTCTAGAGTGAGGGTCCCCACCTGGGACCCTTGAGAGTATCAGGTCTCCCACGTGGGAGACAAGAAATCCCTGTTTAATATTTAAACAGCAGTGTTCCCCATCTGGGTCCTTGCACCCCTCACTCTGGCCTCAGCCGACTGCACAGCGGCCCCTGCATCCCCTTGGCTGTGAGGCCCCTGGACAAGCAGAGGTGGCCAGAGCTGGGAGGCATGGCCCTGGGGTCCCACGAATTTGCTGGGGAATCTCGTTTTTCTTCTTAAGACTTTTGGGACATGGTTTGACTCCCGAACATCACCGACGCGTCTCCTGTTTTTCTGGGTGGCCTCGGGACACCTGCCCTGCCCCCACGAGGGTCAGGACTGTGACTCTTTTTAGGGCCAGGCAGGTGCCTGGACATTTGCCTTGCTGGACGGGGACTGGGGATGTGGGAGGGAGCAGACAGGAGGAATCATGTCAGGCCTGTGTGTGAAAGGAAGCTCCACTGTCACCCTCCACCTCTTCACCCCCCACTCACCAGTGTCCCCTCCACTGTCACATTGTAACTGAACTTCAGGATAATAAAGTGTTTGCCTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGC
DU Number:
DU30467
Genbank:
Species:
Human
Sequence of Insert:
View Sequence

GGATCCATGCAGCAGGCGCCGCAGCCTTACGAGTTCTTCAGCGAGGAGAACAGTCCGAAATGGCGGGGACTGTTGGTCTCGGCCCTGCGGAAGGTTCAGGAACAAGTGCATCCCACTCTCTCAGCTAATGAAGAGTCTCTCTATTATATTGAAGAGCTGATTTTTCAGCTGCTTAATAAATTATGCATGGCCCAGCCAAGGACTGTTCAAGATGTAGAGGAGCGAGTTCAGAAGACCTTTCCTCACCCAATTGATAAATGGGCCATTGCTGATGCACAATCTGCTATAGAAAAACGAAAACGAAGAAATCCTCTTTTACTGCCTGTGGACAAAATCCATCCTTCGTTGAAGGAAGTATTAGGGTACAAAGTGGACTACCATGTATCCCTATATATTGTGGCTGTACTAGAGTATATCTCAGCTGATATTTTAAAATTGGCTGGTAATTATGTTTTTAATATCCGGCATTATGAAATATCTCAGCAGGACATTAAAGTGTCAATGTGTGCGGATAAGGTTTTGATGGACATGTTTGATCAGGATGACATAGGTTTGGTTTCTCTCTGTGAAGATGAACCTAGTTCTTCTGGTGAATTAAACTACTATGATCTTGTCAGAACTGAAATCGCAGAAGAAAGACAGTATCTACGGGAATTAAATATGATCATAAAAGTGTTTCGAGAAGCCTTTCTTTCTGATAGAAAGCTGTTTAAACCTTCTGATATCGAAAAGATTTTTAGTAACATTTCAGATATACATGAATTGACTGTGAAACTTTTAGGTTTGATTGAAGACACAGTTGAAATGACTGATGAAAGCAGTCCTCATCCCTTAGCTGGCAGCTGTTTTGAAGATTTGGCAGAAGAGCAAGCATTTGATCCTTATGAAACATTATCACAGGACATTCTTTCACCAGAGTTTCATGAACATTTCAATAAATTGATGGCCAGACCTGCAGTTGCTCTACACTTTCAGTCCATTGCTGATGGTTTTAAAGAGGCAGTTCGTTATGTCCTTCCACGTCTTATGCTGGTGCCAGTGTATCACTGTTGGCACTACTTTGAGTTACTAAAGCAATTGAAAGCATGTAGTGAAGAACAAGAAGACAGAGAATGTTTGAACCAAGCTATTACTGCTCTCATGAATCTCCAAGGTAGCATGGACCGAATTTACAAGCAGTATTCACCTAGACGTCGACCTGGAGATCCTGTTTGCCCTTTTTATAGTCACCAATTAAGAAGCAAACACCTGGCTATCAAAAAAATGAATGAAATTCAGAAAAATATCGATGGATGGGAAGGCAAAGATATTGGACAGTGTTGTAATGAATTCATTATGGAGGGACCATTGACAAGAATCGGTGCCAAACATGAACGGCATATTTTTCTGTTTGATGGCTTAATGATCAGTTGTAAACCTAATCATGGCCAGACTCGGCTTCCAGGTTACAGTAGTGCAGAATACAGGTTAAAAGAAAAATTTGTCATGAGGAAAATACAAATTTGTGATAAAGAAGATACTTGTGAGCACAAGCATGCATTTGAATTAGTATCCAAAGATGAGAACAGCATAATATTTGCTGCTAAGTCTGCTGAAGAAAAAAACAACTGGATGGCAGCCCTTATTTCTCTTCATTATCGTAGTACTCTAGATCGAATGTTAGATTCAGTATTATTGAAAGAAGAAAATGAGCAACCACTGAGATTACCAAGTCCTGAAGTATATCGTTTTGTAGTAAAAGACTCTGAGGAAAACATTGTTTTTGAAGACAACTTGCAAAGTAGAAGTGGCATCCCCATTATTAAAGGAGGAACTGTAGTGAAATTAATTGAAAGGTTAACATATCATATGTATGCAGATCCCAATTTTGTTCGTACTTTTCTTACCACATATCGTTCATTTTGTAAACCACAGGAATTGCTGAGCTTACTGATTGAACGGTTTGAAATTCCAGAGCCAGAACCTACTGACGCAGACAAATTGGCAATAGAGAAAGGCGAGCAGCCAATCAGTGCAGACCTTAAAAGATTTCGCAAGGAATATGTCCAACCAGTACAACTTAGGATCTTAAATGTATTTCGGCATTGGGTTGAACATCATTTTTATGACTTTGAAAGAGACTTGGAATTGCTTGAAAGACTAGAATCCTTCATTTCAAGTGTAAGAGGGAAAGCTATGAAAAAATGGGTAGAGTCAATTGCTAAGATCATCAGGAGGAAGAAGCAAGCTCAGGCAAACGGAGTAAGCCATAATATTACCTTTGAAAGTCCACCTCCACCAATTGAATGGCATATCAGCAAACCAGGACAGTTTGAAACATTTGATCTCATGACACTTCATCCAATAGAAATTGCACGTCAGCTGACACTTTTGGAGTCTGATCTTTACAGGAAAGTTCAACCGTCTGAACTTGTAGGGAGTGTGTGGACCAAAGAAGATAAAGAAATAAATTCTCCAAATTTATTAAAAATGATTCGCCATACCACAAATCTCACCCTCTGGTTTGAAAAATGCATTGTGGAAGCAGAAAATTTTGAAGAACGGGTGGCAGTACTAAGTAGAATTATAGAAATTCTGCAAGTTTTTCAAGATTTGAATAATTTCAATGGCGTATTGGAGATAGTCAGTGCAGTAAATTCAGTGTCAGTATACAGACTAGACCATACCTTTGAGGCACTGCAGGAAAGGAAAAGGAAAATTTTGGACGAAGCTGTGGAATTAAGTCAAGATCACTTTAAAAAATACCTAGTAAAACTTAAGTCAATCAATCCACCTTGTGTGCCTTTTTTTGGAATATATTTAACAAATATTCTGAAGACCGAAGAAGGGAATAATGATTTTTTAAAAAAGAAAGGGAAAGATTTAATCAATTTCAGTAAGAGGAGGAAAGTAGCTGAAATTACTGGAGAAATTCAGCAGTATCAGAATCAGCCTTACTGTTTACGGATAGAACCAGATATGAGGAGATTCTTTGAAAACCTTAACCCCATGGGAAGTGCATCTGAAAAAGAGTTTACAGATTATTTGTTCAACAAGTCACTAGAAATTGAACCTCGAAACTGCAAACAGCCACCTCGATTTCCTAGGAAATCAACTTTTTCCTTAAAATCTCCTGGAATAAGGCCTAACACAGGCCGACATGGCTCTACCTCAGGTACTTTACGAGGTCACCCAACACCATTAGAAAGAGAACCATGTAAAATAAGCTTTAGTCGGATTGCTGAAACTGAGCTGGAATCAACAGTGTCAGCACCAACCTCTCCAAATACACCATCTACTCCACCAGTATCTGCTTCTTCAGACCTTAGTGTATTTTTAGATGTGGATCTCAACAGCTCCTGTGGCAGCAATAGCATCTTTGCTCCAGTGCTTTTGCCACATTCAAAGTCTTTCTTTAGTTCATGTGGTAGTTTACATAAACTAAGTGAAGAGCCCCTGATTCCTCCTCCTCTTCCTCCTCGAAAAAAGTTTGATCATGATGCTTCAAATTCCAAGGGAAATATGAAATCTGATGATGATCCTCCTGCTATTCCACCGAGACAGCCTCCTCCTCCAAAGGTAAAACCCAGAGTTCCTGTTCCTACTGGTGCATTTGATGGGCCTCTGCATAGTCCACCTCCGCCACCACCAAGAGATCCTCTTCCTGATACCCCTCCACCAGTTCCCCTTCGGCCTCCAGAACACTTTATAAACTGTCCATTTAATCTTCAGCCACCTCCACTGGGGCATCTTCACAGAGATTCAGACTGGCTCAGAGACATTAGTACGTGTCCAAATTCGCCAAGCACTCCTCCTAGCACACCCTCTCCAAGGGTACCGCGTCGATGCTATGTGCTCAGTTCTAGTCAGAATAATCTTGCTCATCCTCCAGCTCCCCCTGTTCCACCAAGGCAGAATTCAAGCCCTCATCTGCCAAAACTGCCACCAAAGACTTACAAACGGGAGCTTTCGCACCCCCCATTGTACAGACTGCCTTTGCTAGAAAATGCAGAAACTCCCCAATGAGCGGCCGC
Amino Acid Sequence:
View Sequence

MAPILGYWKIKGLVQPTRLLLEYLEEKYEEHLYERDEGDKWRNKKFELGLEFPNLPYYIDGDVKLTQSMAIIRYIADKHNMLGGCPKERAEISMLEGAVLDIRYGVSRIAYSKDFETLKVDFLSKLPEMLKMFEDRLCHKTYLNGDHVTHPDFMLYDALDVVLYMDPMCLDAFPKLVCFKKRIEAIPQIDKYLKSSKYIAWPLQGWQATFGGGDHPPKSDLVPRGSLEVLFQGPLGSMQQAPQPYEFFSEENSPKWRGLLVSALRKVQEQVHPTLSANEESLYYIEELIFQLLNKLCMAQPRTVQDVEERVQKTFPHPIDKWAIADAQSAIEKRKRRNPLLLPVDKIHPSLKEVLGYKVDYHVSLYIVAVLEYISADILKLAGNYVFNIRHYEISQQDIKVSMCADKVLMDMFDQDDIGLVSLCEDEPSSSGELNYYDLVRTEIAEERQYLRELNMIIKVFREAFLSDRKLFKPSDIEKIFSNISDIHELTVKLLGLIEDTVEMTDESSPHPLAGSCFEDLAEEQAFDPYETLSQDILSPEFHEHFNKLMARPAVALHFQSIADGFKEAVRYVLPRLMLVPVYHCWHYFELLKQLKACSEEQEDRECLNQAITALMNLQGSMDRIYKQYSPRRRPGDPVCPFYSHQLRSKHLAIKKMNEIQKNIDGWEGKDIGQCCNEFIMEGPLTRIGAKHERHIFLFDGLMISCKPNHGQTRLPGYSSAEYRLKEKFVMRKIQICDKEDTCEHKHAFELVSKDENSIIFAAKSAEEKNNWMAALISLHYRSTLDRMLDSVLLKEENEQPLRLPSPEVYRFVVKDSEENIVFEDNLQSRSGIPIIKGGTVVKLIERLTYHMYADPNFVRTFLTTYRSFCKPQELLSLLIERFEIPEPEPTDADKLAIEKGEQPISADLKRFRKEYVQPVQLRILNVFRHWVEHHFYDFERDLELLERLESFISSVRGKAMKKWVESIAKIIRRKKQAQANGVSHNITFESPPPPIEWHISKPGQFETFDLMTLHPIEIARQLTLLESDLYRKVQPSELVGSVWTKEDKEINSPNLLKMIRHTTNLTLWFEKCIVEAENFEERVAVLSRIIEILQVFQDLNNFNGVLEIVSAVNSVSVYRLDHTFEALQERKRKILDEAVELSQDHFKKYLVKLKSINPPCVPFFGIYLTNILKTEEGNNDFLKKKGKDLINFSKRRKVAEITGEIQQYQNQPYCLRIEPDMRRFFENLNPMGSASEKEFTDYLFNKSLEIEPRNCKQPPRFPRKSTFSLKSPGIRPNTGRHGSTSGTLRGHPTPLEREPCKISFSRIAETELESTVSAPTSPNTPSTPPVSASSDLSVFLDVDLNSSCGSNSIFAPVLLPHSKSFFSSCGSLHKLSEEPLIPPPLPPRKKFDHDASNSKGNMKSDDDPPAIPPRQPPPPKVKPRVPVPTGAFDGPLHSPPPPPPRDPLPDTPPPVPLRPPEHFINCPFNLQPPPLGHLHRDSDWLRDISTCPNSPSTPPSTPSPRVPRRCYVLSSSQNNLAHPPAPPVPPRQNSSPHLPKLPPKTYKRELSHPPLYRLPLLENAETPQ

Do you need any help? Please get in touch and we’ll be happy to lend a hand.