cDNA Clone - AATYK NCBI AY236858

Name: AATYK NCBI AY236858
Price per aliquot: £110.00
Expressed:
FLAG-AATYK 1-672
Plasmid:
pCMV-FLAG AATYK 1-672
Parent Plasmid:
pCMV5 FLAG1
View Parent Plasmid

Snapgene File | Genbank File
cccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagctgatctatacattgaatcaatattggcaattagccatattagtcattggttatatagcataaatcaatattggctattggccattgcatacgttgtatctatatcataatatgtacatttatattggctcatgtccaatatgaccgccatgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtccgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttacgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacaccaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaataaccccgccccgttgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcaGAATTGGCCACCATGgactacaaggacgatgacgataagGGATCCCCGGAATTCCCGGGTCGACTCGAGCGGCCGCGGATCTcgggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtccttctgattttaaaataactataccagcaggaggacgtccagacacagcataggctacctgccatggcccaaccggtgggacatttgagttgcttgcttggcactgtcctctcatgcgttgggtccactcagtagatgcctgttgaattgggtacgcggccagcttctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcctcgaggaactgaaaaaccagaaagttaattccctatagtgagtcgtattaaattcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacaaaatattaacgtttacaatttc
DU Number:
DU6772
Genbank:
Synonyms:
AATK
Sequence of Insert:
View Sequence

GAATTCGCCCTTAGATCTATGTCGTCGTCCTTCTTCAACCCCAGCTTTGCCTTCAGCTCCCACTTCGACCCGGACGGTGCCCCGCTCAGTGAGCTGTCCTGGTCCTCGTCCCTCGCGGTGGTAGCCGTGTCCTTCTCTGGAATCTTCACTGTCGTCATCCTCATGCTGGCCTGCCTGTGTTGTAAGAAGGGCGGCATCGGGTTCAAGGAGTTTGAGAATGCTGAAGGGGATGAGTATGTGGCCGACTTCTCGGAGCAGGGCTCCCCGGCTGCAGCTGCACAGACCGGCCCCGATGTGTATGTCCTGCCCCTCACCGAGGTCTCCTTACCCATGGCCAAGCAGCCGGGTCGCTCCGTGCAACTTCTCAAGTCCACGGACCTGGGCCGGCACAGCCTCCTGTACTTAAAGGAGATTGGCCACGGCTGGTTTGGGAAGGTGTTTTTGGGGGAGGTACACTCGGGCGTCAGTGGCACGCAGGTGGTGGTGAAGGAGCTGAAGGTGAGCGCCAGCGTGCAGGAGCAGATGCAGTTCCTGGAGGAGGCGCAGCCCTACAGGGCCCTGCAGCACAGCAACCTGCTCCAGTGCCTGGCCCAGTGTGCTGAAGTGACCCCCTACCTGCTGGTTATGGAGTTCTGTCCACTGGGGGACCTCAAAGGTTATCTACGGAGCTGCCGGGTGACAGAGTCCATGGCGCCTGACCCACTTACCTTGCAGCGCATGGCGTGCGAGGTGGCGTGTGGCGTCTTGCATCTACATCGACACAACTATGTACACAGTGACCTGGCCCTGAGGAACTGCCTGCTTACGGCTGACCTGACAGTGAAGGTTGGTGATTATGGCCTGTCGCATTGCAAATACAGGGAAGACTATCTCGTGACCGCTGACCAGCTGTGGGTGCCGCTGCGCTGGATCGCGCCAGAGCTGGTGGACGAGGTTCACGGCAACCTGCTGGTGGTGGACCAGACCAAGAGCAGCAACGTGTGGTCCCTGGGTGTGACCATCTGGGAGCTTTTCGAGTTGGGTGCGCAGCCGTACCCCCAGCACTCGGACCGGCAGGTGCTGGCTTACGCCGTCCGGGAGCAGCAGCTTAAGTTGCCCAAGCCCCAGCTGCAGCTGGCTCTATCTGATCGATGGTACGAGGTGATGCAGTTCTGCTGGCTGCAGCCAGAGCAGAGGCCCACAGCTGAAGAGGTTCATCTACTGCTGTCCTACTTGTGTGCTAAGGGCACCACAGAATTGGAGGAGGAGTTTGAGCGGCGCTGGCGCTCCCTGCGGCCCGGGGGCAGCACGGGCCTGGGCTCGGGTTCTGCAGCCCCAGCAGCTGCCACCGCCGCCTCCGCGGAGCTCACCGCTGCCTCGTCTTTCCCGCTGCTGGAGCGGTTCACCAGCGACGGCTTTCACGTGGACAGTGATGACGTGCTGACGGTCACGGAGACAAGCCACGGCCTCAACTTTGAATACAAGTGGGAGGCTGGCTGTGGCGCTGAGGAGTACCCACCCTCGGGGGCTGCATCAAGCCCAGGCTCGGCAGCGCGCCTGCAGGAGTTGTGCGCGCCTGACAGTTCACCGCCGGGTGTGGTGCCAGTCCTCAGTGCCCACAGCCCCTCAGTGGGTAGCGAGTACTTCATCCGCCTGGAGGGGGCAGTGCCTGCTGCTGGCCACGATCCAGACTGTGCCGGCTGCGCTCCCAGCCCCCAGGCTGTGACTGACCAGGACAATAACTCTGAGGAGAGCACTGTTGCGTCCCTTGCCATGGAGCCATTGCTGGGCCATGCACCCCCAACTGAGGGTCTGTGGGGCCCCTGTGACCACCATTCACATAGGAGGCAAGGGTCACCCTGTCCCTCACGCTCACCCTCTCCTGGGACCCCGATGTTGCCAGCTGAAGACATAGACTGGGGTGTGGCTACCTTCTGCCCGCCCTTCTTTGATGACCCACTGGGTGCATCTCCCTCGGGGAGTCCTGGGGCCCAGCCCTCCCCCAGTGATGAGGAGCCAGAGGAGGGGAAGGTGGGGTTGGCCGCTCAGTGTGGACACTGGAGCTCTAACATGTCAGCTAACAACAACAGTGCCAGTCGCGACCCAGAATCCTGGGATCCTGGCTATGTTAGCAGCTTCACAGACAGCTACAGGGACGACTGCTCCAGCTTAGAGCAGACCCCTCGAGCCTCCCAAGGGCGAATTCCAGCACACTGGCGGCCGTTACTAGTGGAT
Amino Acid Sequence:
View Sequence

MDYKDDDDKGSPEFALRSMSSSFFNPSFAFSSHFDPDGAPLSELSWSSSLAVVAVSFSGIFTVVILMLACLCCKKGGIGFKEFENAEGDEYVADFSEQGSPAAAAQTGPDVYVLPLTEVSLPMAKQPGRSVQLLKSTDLGRHSLLYLKEIGHGWFGKVFLGEVHSGVSGTQVVVKELKVSASVQEQMQFLEEAQPYRALQHSNLLQCLAQCAEVTPYLLVMEFCPLGDLKGYLRSCRVTESMAPDPLTLQRMACEVACGVLHLHRHNYVHSDLALRNCLLTADLTVKVGDYGLSHCKYREDYLVTADQLWVPLRWIAPELVDEVHGNLLVVDQTKSSNVWSLGVTIWELFELGAQPYPQHSDRQVLAYAVREQQLKLPKPQLQLALSDRWYEVMQFCWLQPEQRPTAEEVHLLLSYLCAKGTTELEEEFERRWRSLRPGGSTGLGSGSAAPAAATAASAELTAASSFPLLERFTSDGFHVDSDDVLTVTETSHGLNFEYKWEAGCGAEEYPPSGAASSPGSAARLQELCAPDSSPPGVVPVLSAHSPSVGSEYFIRLEGAVPAAGHDPDCAGCAPSPQAVTDQDNNSEESTVASLAMEPLLGHAPPTEGLWGPCDHHSHRRQGSPCPSRSPSPGTPMLPAEDIDWGVATFCPPFFDDPLGASPSGSPGAQPSPSDEEPEEGKVGLAAQCGHWSSNMSANNNSASRDPESWDPGYVSSFTDSYRDDCSSLEQTPRASQGRIPGSTRAAAIPVTPPQCLSWPWKLPLQCPPALS
Antibiotic:
Amp
Comments:
No STOP after AA 718; Cut for Ciaran to test N-C term binding.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.