cDNA Clone - ABR2

Name: ABR2
Price per aliquot: £110.00
Expressed:
GST-6-ABR2 Long
Plasmid:
pGEX-6-ABR2 Long
Parent Plasmid:
pGEX6P1 mod
View Parent Plasmid

|
DU Number:
DU6676
Genbank:
Species:
Human
Sequence of Insert:
View Sequence

GAATTCGCCCTTACTAGTATGGAGCCGCTCAGCCACCGGGGCCTGCCGCGCCTGTCCTGGATCGACACCCTCTACAGCAACTTCAGCTACGGGACGGACGAGTACGACGGAGAGGGGAATGAGGAGCAGAAGGGGCCCCCGGAGGGCTCAGAGACCATGCCGTACATCGATGAGTCGCCCACCATGTCCCCGCAGCTCAGCGCCCGCAGCCAGGGCGGGGGGGATGGCGTCTCCCCGACTCCACCTGAGGGACTGGCTCCTGGGGTGGAAGCAGGGAAAGGCCTGGAGATGAGGAAGCTGGTTCTCTCGGGGTTCTTGGCCAGCGAAGAGATCTACATTAACCAGCTGGAAGCCCTGTTGTTGCCCATGAAACCCCTGAAGGCCACCGCCACCACCTCCCAGCCCGTGCTCACCATCCAGCAGATCGAGACCATCTTCTACAAGATCCAGGACATCTATGAGATCCACAAGGAGTTCTATGACAACCTGTGCCCCAAGGTGCAACAGTGGGACAGCCAGGTCACCATGGGCCACCTCTTCCAGAAGCTGGCCAGCCAGCTCGGTGTGTACAAAGCGTTTGTCGATAACTATAAAGTCGCTCTGGAGACAGCTGAGAAGTGCAGCCAGTCCAACAACCAGTTCCAGAAGATCTCAGAGGAACTCAAAGTGAAAGGTCCCAAGGACTCCAAGGACAGCCACACGTCTGTCACCATGGAAGCTCTGCTCTACAAGCCCATTGACCGGGTCACTCGGAGCACCCTAGTCCTACACGACCTGCTGAAGCACACACCTGTGGACCGCCCCGACTACCCGCTGCTGCAGGATGCCCTCCGCATCTCCCAGAACTTCCTGTCCAGCATCAACGAGGACGTCGACCCCCGCCGGACTGCAGTGACAACGCCCAAGGGGGAGACGCGACAGCTGGTGAAGGACGGCTTCCTGGTGGAAGTGTCAGAGAGCTCCCGGAAGCTGCGGCACGTCTTCCTCTTTACAGATGTCCTACTGTGTGCCAAGCTGAAGAAGACCTCTGCAGGGAAGCACCAGCAGTATGACTGTAAGTGGTACATCCCCCTGGCCGACCTGGTGTTTCCATCCCCCGAGGAATCTGAGGCCAGCCCCCAGGTGCACCCCTTCCCAGACCATGAGCTGGAGGACATGAAGATGAAGATCTCTGCCCTCAAGAGTGAAATCCAGAAGGAGAAAGCCAACAAAGGCCAGAGCCGGGCCATCGAGCGCCTGAAGAAGAAGATGTTTGAGAATGAGTTCCTGCTGCTGCTCAACTCCCCCACAATCCCGTTCAGGATCCACAATCGGAATGGAAAGAGTTACCTGTTCCTACTGTCCTCGGACTACGAGAGGTCAGAGTGGAGAGAAGCAATTCAGAAACTACAGAAGAAGGATCTCCAGGCCTTTGTCCTGAGCTCAGTGGAGCTCCAGGTGCTCACAGGATCCTGTTTCAAGCTTAGGACTGTACACAACATTCCTGTCACCAGCAATAAAGACGACGATGAGTCTCCAGGACTCTATGGCTTCCTTCATGTCATCGTCCACTCTGCCAAGGGATTTAGGCAATCAGCCAACCTGTACTGTACCCTGGAGGTGGATTCCTTCGGCTATTTTGTCAGCAAAGCCAAAACCAGGGTGTTCCGGGACACAGCGGAGCCCAAGTGGGATGAGGAGTTTGAGATCGAGCTGGAGGGCTCCCAGTCCCTGAGGATCCTGTGCTATGAGAAGTGCTATGACAAGACCAAGGTCAACAAGGACAACAATGAGATCGTGGACAAGATCATGGGCAAAGGACAGATCCAGCTGGACCCACAAACCGTGGAGACCAAGAACTGGCACACGGACGTGATTGAGATGAACGGGATCAAAGTGGAATTTTCCATGAAATTCACCAGCCGAGATATGAGCCTGAAGAGGACCCCGTCCAAAAAGCAGACCGGCGTCTTCGGTGTGAAGATCAGCGTGGTGACGAAGCGGGAGCGCTCCAAGGTGCCCTACATCGTCCGGCAGTGTGTGGAGGAGGTGGAGAAGAGGGGTATCGAGGAGGTTGGCATCTACAGGATATCGGGCGTGGCCACGGACATCCAGGCGCTCAAGGCCGTCTTCGATGCCAATAACAAGGACATCCTGCTGATGCTGAGTGACATGGACATCAACGCCATCGCCGGGACGCTCAAGCTGTACTTCCGGGAACTGCCCGAGCCGCTCGTCACGGACCGACTCTACCCAGCCTTCATGGAGGGCATCGCCCTGTCAGACCCTGCTGCCAAGGAAAACTGCATGATGCACCTGCTCCGCTCCCTGCCCGACCCCAACCTCATCACCTTCCTCTTCCTACTGGAACACTTGAAAAGGGTTGCCGAGAAGGAGCCCATCAACAAAATGTCACTTCACAACCTGGCTACCGTGTTTGGACCCACGTTACTGAGACCCTCAGAAGTGGAGAGCAAAGCACACCTCACCTCGGCTGCGGACATCTGGTCCCATGACGTCATGGCGCAGGTCCAGGTCCTCCTCTACTACCTGCAGCACCCCCCCATTTCCTTCGCAGAACTCAAGCGGAACACACTGTACTTCTCCACCGACGTGTAGCGGCCGCAAGGGCGAATTC
Amino Acid Sequence:
View Sequence

MSPILGYWKIKGLVQPTRLLLEYLEEKYEEHLYERDEGDKWRNKKFELGLEFPNLPYYIDGDVKLTQSMAIIRYIADKHNMLGGCPKERAEISMLEGAVLDIRYGVSRIAYSKDFETLKVDFLSKLPEMLKMFEDRLCHKTYLNGDHVTHPDFMLYDALDVVLYMDPMCLDAFPKLVCFKKRIEAIPQIDKYLKSSKYIAWPLQGWQATFGGGDHPPKSDLEVLFQGPLGSPEFALMHTSMEPLSHRGLPRLSWIDTLYSNFSYGTDEYDGEGNEEQKGPPEGSETMPYIDESPTMSPQLSARSQGGGDGVSPTPPEGLAPGVEAGKGLEMRKLVLSGFLASEEIYINQLEALLLPMKPLKATATTSQPVLTIQQIETIFYKIQDIYEIHKEFYDNLCPKVQQWDSQVTMGHLFQKLASQLGVYKAFVDNYKVALETAEKCSQSNNQFQKISEELKVKGPKDSKDSHTSVTMEALLYKPIDRVTRSTLVLHDLLKHTPVDRPDYPLLQDALRISQNFLSSINEDVDPRRTAVTTPKGETRQLVKDGFLVEVSESSRKLRHVFLFTDVLLCAKLKKTSAGKHQQYDCKWYIPLADLVFPSPEESEASPQVHPFPDHELEDMKMKISALKSEIQKEKANKGQSRAIERLKKKMFENEFLLLLNSPTIPFRIHNRNGKSYLFLLSSDYERSEWREAIQKLQKKDLQAFVLSSVELQVLTGSCFKLRTVHNIPVTSNKDDDESPGLYGFLHVIVHSAKGFRQSANLYCTLEVDSFGYFVSKAKTRVFRDTAEPKWDEEFEIELEGSQSLRILCYEKCYDKTKVNKDNNEIVDKIMGKGQIQLDPQTVETKNWHTDVIEMNGIKVEFSMKFTSRDMSLKRTPSKKQTGVFGVKISVVTKRERSKVPYIVRQCVEEVEKRGIEEVGIYRISGVATDIQALKAVFDANNKDILLMLSDMDINAIAGTLKLYFRELPEPLVTDRLYPAFMEGIALSDPAAKENCMMHLLRSLPDPNLITFLFLLEHLKRVAEKEPINKMSLHNLATVFGPTLLRPSEVESKAHLTSAADIWSHDVMAQVQVLLYYLQHPPISFAELKRNTLYFSTDV
Antibiotic:
Amp
Comments:
Amplified from EST: NCBI: BG771964, IMAGE:4838372 The Amino acids of EST BM473396 are identical with this EST therefore we did not mutate them to the above NCBI Acc. Number. Changes compared to Sequence NP_068781: H216 IS R I285 IS V K517 IS R L733 IS V

Do you need any help? Please get in touch and we’ll be happy to lend a hand.