cDNA Clone - SMURF2

Name: SMURF2
Price per aliquot: £110.00
Expressed:
FLAG SMURF2
Plasmid:
pCMV5-FLAG-2 SMURF2
Parent Plasmid:
pCMV5 FLAG2
View Parent Plasmid

Snapgene File | Genbank File
cccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagctgatctatacattgaatcaatattggcaattagccatattagtcattggttatatagcataaatcaatattggctattggccattgcatacgttgtatctatatcataatatgtacatttatattggctcatgtccaatatgaccgccatgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtccgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttacgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacaccaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaataaccccgccccgttgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcaGAATTGGCCACCATGgactacaaggacgatgacgataaggGGATCCCCGGAATTCCCGGGTCGACTCGAGCGGCCGCGGATCTcgggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtccttctgattttaaaataactataccagcaggaggacgtccagacacagcataggctacctgccatggcccaaccggtgggacatttgagttgcttgcttggcactgtcctctcatgcgttgggtccactcagtagatgcctgttgaattgggtacgcggccagcttctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcctcgaggaactgaaaaaccagaaagttaattccctatagtgagtcgtattaaattcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcggggcatccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacaaaatattaacgtttacaatttc
DU Number:
DU32593
Species:
Human
Sequence of Insert:
View Sequence

ATGTCTAACCCCGGAGGCCGGAGGAACGGGCCCGTCAAGCTGCGCCTGAC AGTACTCTGTGCAAAAAACCTGGTGAAAAAGGATTTTTTCCGACTTCCTG ATCCATTTGCTAAGGTGGTGGTTGATGGATCTGGGCAATGCCATTCTACA GATACTGTGAAGAATACGCTTGATCCAAAGTGGAATCAGCATTATGACCT GTATATTGGAAAGTCTGATTCAGTTACGATCAGTGTATGGAATCACAAGA AGATCCATAAGAAACAAGGTGCTGGATTTCTCGGTTGTGTTCGTCTTCTT TCCAATGCCATCAACCGCCTCAAAGACACTGGTTATCAGAGGTTGGATTT ATGCAAACTCGGGCCAAATGACAATGATACAGTTAGAGGACAGATAGTAG TAAGTCTTCAGTCCAGAGACCGAATAGGCACAGGAGGACAAGTTGTGGAC TGCAGTCGTTTATTTGATAACGATTTACCAGACGGCTGGGAAGAAAGGAG AACCGCCTCTGGAAGAATCCAGTATCTAAACCATATAACAAGAACTACGC AATGGGAGCGCCCAACACGACCGGCATCCGAATATTCTAGCCCTGGCAGA CCTCTTAGCTGCTTTGTTGATGAGAACACTCCAATTAGTGGAACAAATGG TGCAACATGTGGACAGTCTTCAGATCCCAGGCTGGCAGAGAGGAGAGTCA GGTCACAACGACATAGAAATTACATGAGCAGAACACATTTACATACTCCT CCAGACCTACCAGAAGGCTATGAACAGAGGACAACGCAACAAGGCCAGGT GTATTTCTTACATACACAGACTGGTGTGAGCACATGGCATGATCCAAGAG TGCCCAGGGATCTTAGCAACATCAATTGTGAAGAGCTTGGTCCATTGCCT CCTGGATGGGAGATCCGTAATACGGCAACAGGCAGAGTTTATTTCGTTGA CCATAACAACAGAACAACACAATTTACAGATCCTCGGCTGTCTGCTAACT TGCATTTAGTTTTAAATCGGCAGAACCAATTGAAAGACCAACAGCAACAG CAAGTGGTATCGTTATGTCCTGATGACACAGAATGCCTGACAGTCCCAAG GTACAAGCGAGACCTGGTTCAGAAACTAAAAATTTTGCGGCAAGAACTTT CCCAACAACAGCCTCAGGCAGGTCATTGCCGCATTGAGGTTTCCAGGGAA GAGATTTTTGAGGAATCATATCGACAGGTCATGAAAATGAGACCAAAAGA TCTCTGGAAGCGATTAATGATAAAATTTCGTGGAGAAGAAGGCCTTGACT ATGGAGGCGTTGCCAGGGAATGGTTGTATCTCTTGTCACATGAAATGTTG AATCCATACTATGGCCTCTTCCAGTATTCAAGAGATGATATTTATACATT GCAGATCAATCCTGATTCTGCAGTTAATCCGGAACATTTATCCTATTTCC ACTTTGTTGGACGAATAATGGGAATGGCTGTGTTTCATGGACATTATATT GATGGTGGTTTCACATTGCCTTTTTATAAGCAATTGCTTGGGAAGTCAAT TACCTTGGATGACATGGAGTTAGTAGATCCGGATCTTCACAACAGTTTAG TGTGGATACTTGAGAATGATATTACAGGTGTTTTGGACCATACCTTCTGT GTTGAACATAATGCATATGGTGAAATTATTCAGCATGAACTTAAACCAAA TGGCAAAAGTATCCCTGTTAATGAAGAAAATAAAAAAGAATATGTCAGGC TCTATGTGAACTGGAGATTTTTACGAGGCATTGAGGCTCAATTCTTGGCT CTGCAGAAAGGATTTAATGAAGTAATTCCACAACATCTGCTGAAGACATT TGATGAGAAGGAGTTAGAGCTCATTATTTGTGGACTTGGAAAGATAGATG TTAATGACTGGAAGGTAAACACCCGGTTAAAACACTGTACACCAGACAGC AACATTGTCAAATGGTTCTGGAAAGCTGTGGAGTTTTTTGATGAAGAGCG ACGAGCAAGATTGCTTCAGTTTGTGACAGGATCCTCTCGAGTGCCTCTGC AGGGCTTCAAAGCATTGCAAGGTGCTGCAGGCCCGAGACTCTTTACCATA CACCAGATTGATGCCTGCACTAACAACCTGCCGAAAGCCCACACTTGCTT CAATCGAATAGACATTCCACCCTATGAAAGCTATGAAAAGCTATATGAAA AGCTGCTAACAGCCATTGAAGAAACATGTGGATTTGCTGTGGAATGA
Amino Acid Sequence:
View Sequence

DYKDDDDKGIPGIPGSTRAAAMSNPGGRRNGPVKLRLTVLCAKNLVKKDFFRLPDPFAKVVVDGSGQCHSTDTVKNTLDPKWNQHYDLYIGKSDSVTISVWNHKKIHKKQGAGFLGCVRLLSNAINRLKDTGYQRLDLCKLGPNDNDTVRGQIVVSLQSRDRIGTGGQVVDCSRLFDNDLPDGWEERRTASGRIQYLNHITRTTQWERPTRPASEYSSPGRPLSCFVDENTPISGTNGATCGQSSDPRLAERRVRSQRHRNYMSRTHLHTPPDLPEGYEQRTTQQGQVYFLHTQTGVSTWHDPRVPRDLSNINCEELGPLPPGWEIRNTATGRVYFVDHNNRTTQFTDPRLSANLHLVLNRQNQLKDQQQQQVVSLCPDDTECLTVPRYKRDLVQKLKILRQELSQQQPQAGHCRIEVSREEIFEESYRQVMKMRPKDLWKRLMIKFRGEEGLDYGGVAREWLYLLSHEMLNPYYGLFQYSRDDIYTLQINPDSAVNPEHLSYFHFVGRIMGMAVFHGHYIDGGFTLPFYKQLLGKSITLDDMELVDPDLHNSLVWILENDITGVLDHTFCVEHNAYGEIIQHELKPNGKSIPVNEENKKEYVRLYVNWRFLRGIEAQFLALQKGFNEVIPQHLLKTFDEKELELIICGLGKIDVNDWKVNTRLKHCTPDSNIVKWFWKAVEFFDEERRARLLQFVTGSSRVPLQGFKALQGAAGPRLFTIHQIDACTNNLPKAHTCFNRIDIPPYESYEKLYEKLLTAIEETCGFAVE
Antibiotic:
Amp
Comments:
Estimated MW of expressed protein : 88354.14 Daltons

Do you need any help? Please get in touch and we’ll be happy to lend a hand.