cDNA Clone - AKTIP

Price per aliquot: £110.00
Parent Plasmid:
View Parent Plasmid

Snapgene File | Genbank File
DU Number:
AKT-interacting protein, Fused Toes Protein Homolog
Sequence of Insert:
View Sequence

ggatccatgaaccctttctggagcatgtctacaagctctgtacgcaaacg atctgaaggtgaagagaagacattaacaggggacgtgaaaaccagtcctc cacgaactgcaccaaagaaacagctgccttctattcccaaaaatgctttg cccataactaagcctacatctcctgccccagcagcacagtcaacaaatgg cacgcatgcgtcctatggacccttctacctggaatactctcttcttgcag aatttaccttggttgtgaagcagaagctaccaggcgtctatgtgcagcca tcttatcgctctgcattaatgtggtttggagtaatattcatacggcatgg actttaccaagatggcgtatttaagtttacagtttacatccctgataact atccagatggtgactgtccacgcttggtgttcgatattcctgtctttcac ccgctagttgatcccacctcaggtgagctggatgtgaagagagcatttgc aaaatggaggcggaaccataatcatatttggcaggtattaatgtatgcaa ggagagttttctacaagattgatacagcaagccccctgaacccagaggct gcagtactgtatgaaaaagatattcagctttttaaaagtaaagttgttga cagtgttaaggtgtgcactgctcgtttgtttgaccaacctaaaatagaag acccctatgcaattagcttttctccatggaatccttctgtacatgatgaa gccagagaaaagatgctgactcagaaaaagcctgaagaacagcacaataa aagtgttcatgttgctggcctgtcatgggtaaagcctggctcagtacagc ctttcagtaaagaagagaaaacagtggcgacttaaGCGGCCGCCC
Amino Acid Sequence:
View Sequence


Do you need any help? Please get in touch and we’ll be happy to lend a hand.