cDNA Clone - ABIN1 (mouse)

Name: ABIN1 (mouse)
Price per aliquot: £110.00
HA ABIN1 (mouse) 1-560 D485N
pCMV-HA ABIN1 (mouse) 1-560 D485N
Parent Plasmid:
View Parent Plasmid

Snapgene File | Genbank File
DU Number:
Sequence of Insert:
View Sequence

GGATCCatggaagggagaggaccctaccggatctacgacccagggggcagcacgcctctgggagaggtgtccgcagcttttgaacgtctagtggaggaga atactcggctgaagggaaaaatgcaagggataaagatgttaggggagcttctggaggagtctcagatggaagcgtccagactccggcagaaggcagagga gctggtcaaggacagcgagctgtcaccaccgacatctgccccctccttggtctcctttgatgacctggctgagctcacaggacaggatacaaaggtccag gtacatcctgctaccagcactgccgccaccaccaccgccaccgccaccacgggaaactccatggagaagcccgagccagcctccaaatctccgtccaatg gcgcctcctcggactttgaagtggtccctactgaggagcagaattcacccgaaactggcagccaccctacgaacatgatggacctggggcccccaccccc agaggacagcaacctgaagctccacctgcagcgcctggagaccacccttagcgtgtgtgcagaggagccagaccacagccagctcttcacccacctgggc cgcatggccctcgagttcaacaggttggcctccaaagtgcataaaaatgagcagcgcacctccatcctgcagaccttatgtgagcagctgcgccaggaga atgaagccctgaaggccaagctggacaagggcctggaacagcgggatctggctgctgagaggctgcgggaggaaaacacggagctcaagaaactgttgat gaacagcagctgcaaagagggactctgtgggcagcccagctccccaaagccagagggtgctggcaagaagggcgtggctggacagcagcaggccagtgtg atggcgagtaaagtccctgaagcgggggcctttggagcagctgagaagaaagtgaagttgctagaacagcaacgcatggagctgctggaagtgaacaagc agtgggaccagcatttccggtccatgaagcagcagtatgagcagaagatcacagagcttcgccagaagctggtggacctgcagaaacaggtaactgagct ggaggccgaacgggagcagaagcagcgtgactttgaccggaaactcctcctggccaaatcgaagatagagatggaagagaccgacaaggagcagctgaca gcagaggccaaggaactgcgccagaaggtcaggtacctacaggatcagctgagcccgctcacaaggcaacgagaataccaggagaaggagatccagcggc tcaataaggccctggaggaggccctcagcatccaggcctctccatcatctccgcctgcagcttttgggagtccagaaggcgttgggggccatctgaggaa gcaggaactagtgacacagaatgagttgctgaaacagcaggtaaagatctttgaagagaacttccagagggaacggagtgaccgtgaacgcatgaatgaa gagaaggaggagctgaagaagcaagtagagaagctgcaggcccaggtcaccctgactaatgcccagctcaaaactctcaaagaggaggagaaggccaagg aagccctcaaacagcagaagaggaaagcaaaggcttcgggagagcgctaccacatggaaccccaccctgagcacgtctgcggcgcctaaccctatgccta cccacccatgccagccatggtacctcaccatgcctacaatgactgtgatgggccccagtgagcggccgc
Amino Acid Sequence:
View Sequence


Do you need any help? Please get in touch and we’ll be happy to lend a hand.