cDNA Clone - 14-3-3 zeta

Name: 14-3-3 zeta
Price per aliquot: £50.00
Expressed:
DS Red-14-3-3-zeta
Plasmid:
DS Red-C1 14-3-3-zeta
Parent Plasmid:
pDS RED C1
View Parent Plasmid

Snapgene File | Genbank File
TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATA TGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCG CCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGT AACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGT AAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCC CCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTA CATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCA TCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGA TAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAA TGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTA ACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAG GTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTA CCGGTCGCCACCATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCAT GCGCTTCAAGGTGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGA TCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAG CTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTC CCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACA TCCCCGACTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGC GTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTC CCTGCAGGACGGCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACT TCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCC TCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCA CAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGT CCATCTACATGGCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTG GACTCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGA GCAGTACGAGCGCACCGAGGGCCGCCACCACCTGTTCCTGCTCAGATCTC GAGCTCAAGCTTCGAATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCC ACCGGATCTAGATAACTGATCATAATCAGCCATACCACATTTGTAGAGGT TTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATA AAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGT TACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTC ACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTAACGCG TAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTA AATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATA AATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAAC AAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAAC CGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTT TTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGC CCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGA AGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGG TCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAG GGCGCGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTG TTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAAC CCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTCCTGAGGCGGAA AGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGC TCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAAC CAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCA TGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATC CCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACT AATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTAT TCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAGAT CGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGAT TGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGAC TGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTC AGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCC TGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACG GGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGA CTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACC TTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTG CATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCG CATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATG ATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGG CTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGA TGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCA TCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTG GCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTT CCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCT ATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGA CCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCC GCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTG GATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCTA GGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGC GCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGTGTTGGGTCGTT TGTTCATAAACGCGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCC CACCGAGACCCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCA CCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGG GGCGGCAGGCCCTGCCATAGCCTCAGGTTACTCATATATACTTTAGATTG ATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTT GATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGC GTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTC TGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTG GTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGG CTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGT TAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTG CTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTAC CGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCT GAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACC GAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGA AGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAG AGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCT GTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTC AGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGT TCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCC CCTGATTCTGTGGATAACCGTATTACCGCCATGCAT​
DU Number:
DU3182
Synonyms:
YWHAZ
Sequence of Insert:
View Sequence

Amino Acid Sequence:
View Sequence

Do you need any help? Please get in touch and we’ll be happy to lend a hand.