Wild-type, Full-Length


cDNA Synonyms: 
UBA3, Ubiquitin-Activating Enzyme E1 Homolog
DU Number: 
NP_003959.3, NP_003896
Vector Type: 
Sequence of Insert: 
Amino Acid Sequence: 
Price: £125.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 


cDNA Synonyms: 
SHANK-associated RH domain interactor
shank-associated RH domain-interacting protein
shank-interacting protein-like 1
DU Number: 
Cost of Production: 
pFBDMb-6His-3C-HOIL1, HOIP, StrepII-Sharpin
NM_030974.4 → NP_112236.3
Vector Type: 
Sequence of Insert: 
Amino Acid Sequence: 
Price: £125.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 


cDNA Synonyms: 
E3 ubiquitin ligase
E3 ubiquitin-protein ligase parkin
Parkinson disease (autosomal recessive
juvenile) 2
parkin 2
parkinson disease protein 2
parkinson juvenile disease protein 2
DU Number: 
Cost of Production: 
pcDNA5frtTO bdTag- Parkin
Vector Type: 
Sequence of Insert: 
see attached Snapgene file
Amino Acid Sequence: 
see attached Snapgene file
Price: £125.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Cost Centre: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 


cDNA Synonyms: 
DU Number: 
pBabeD puro TFEB-GFP (CPHK87)
NM_001167827.1 GI:268607699
Vector Type: 
Amino Acid Sequence: 
Price: £125.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Full Snapgene Map: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 


cDNA Synonyms: 
E3 ubiquitin ligase
E3 ubiquitin-protein ligase parkin
Parkinson disease (autosomal recessive
juvenile) 2
parkin 2
parkinson disease protein 2
parkinson juvenile disease protein 2
DU Number: 
Cost of Production: 
pcDNA5frtTO HALO-Parkin
Vector Type: 
Sequence of Insert: 
see attached Snapgene file
Amino Acid Sequence: 
see attached Snapgene file
Price: £125.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Cost Centre: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 


cDNA Synonyms: 
E3 ubiquitin ligase
E3 ubiquitin-protein ligase parkin
Parkinson disease (autosomal recessive
juvenile) 2
parkin 2
parkinson disease protein 2
parkinson juvenile disease protein 2
DU Number: 
pcDNA5frtTO bdTag- Parkin
Vector Type: 
Sequence of Insert: 
see attached Snapgene file
Amino Acid Sequence: 
see attached Snapgene file
Price: £125.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Cost Centre: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 


cDNA Synonyms: 
E3 ubiquitin ligase
E3 ubiquitin-protein ligase parkin
Parkinson disease (autosomal recessive
juvenile) 2
parkin 2
parkinson disease protein 2
parkinson juvenile disease protein 2
DU Number: 
pcDNA5frtTO HALO DU 3C-Parkin
Vector Type: 
Sequence of Insert: 
GGATCCGCCACCatgatagtgtttgtcaggttcaactccagccatggttt cccagtggaggtcgattctgacaccagcatcttccagctcaaggaggtgg ttgctaagcgacagggggttccggctgaccagttgcgtgtgattttcgca gggaaggagctgaggaatgactggactgtgcagaattgtgacctggatca gcagagcattgttcacattgtgcagagaccgtggagaaaaggtcaagaaa tgaatgcaactggaggcgacgaccccagaaacgcggcgggaggctgtgag cgggagccccagagcttgactcgggtggacctcagcagctcagtcctccc aggagactctgtggggctggctgtcattctgcacactgacagcaggaagg actcaccaccagctggaagtccagcaggtagatcaatctacaacagcttt tatgtgtattgcaaaggcccctgtcaaagagtgcagccgggaaaactcag ggtacagtgcagcacctgcaggcaggcaacgctcaccttgacccagggtc catcttgctgggatgatgttttaattccaaaccggatgagtggtgaatgc caatccccacactgccctgggactagtgcagaatttttctttaaatgtgg agcacaccccacctctgacaaggaaacatcagtagctttgcacctgatcg caacaaatagtcggaacatcacttgcattacgtgcacagacgtcaggagc cccgtcctggttttccagtgcaactcccgccacgtgatttgcttagactg tttccacttatactgtgtgacaagactcaatgatcggcagtttgttcacg accctcaacttggctactccctgccttgtgtggctggctgtcccaactcc ttgattaaagagctccatcacttcaggattctgggagaagagcagtacaa ccggtaccagcagtatggtgcagaggagtgtgtcctgcagatggggggcg tgttatgcccccgccctggctgtggagcggggctgctgccggagcctgac cagaggaaagtcacctgcgaagggggcaatggcctgggctgtgggtttgc cttctgccgggaatgtaaagaagcgtaccatgaaggggagtgcagtgccg tatttgaagcctcaggaacaactactcaggcctacagagtcgatgaaaga gccgccgagcaggctcgttgggaagcagcctccaaagaaaccatcaagaa aaccaccaagccctgtccccgctgccatgtaccagtggaaaaaaatggag gctgcatgcacatgaagtgtccgcagccccagtgcaggctcgagtggtgc tggaactgtggctgcgagtggaaccgcgtctgcatgggggaccactggtt cgacgtgtagGCGGCCGC
Amino Acid Sequence: 
Price: £125.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Cost Centre: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 


cDNA Synonyms: 
ring finger protein 31 (RNF31) (HOIP)
DU Number: 
Vector Type: 
Sequence of Insert: 
see attached Snapgene file
Amino Acid Sequence: 
see attached Snapgene file
Price: £125.00
Completion Time: 
Research Area: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 


cDNA Synonyms: 
SHANK-associated RH domain interactor
shank-associated RH domain-interacting protein
shank-interacting protein-like 1
DU Number: 
Cost of Production: 
NM_030974.4 → NP_112236.3
Vector Type: 
Sequence of Insert: 
Amino Acid Sequence: 
Price: £125.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 

UBXN7 (Human)

cDNA Synonyms: 
DU Number: 
UBXN7 (Human)
Vector Type: 
Amino Acid Sequence: 
Price: £125.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Cost Centre: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 


Do you need any help? Please get in touch and we’ll be happy to lend a hand.