
cDNA Synonyms: 
E3 ubiquitin ligase
E3 ubiquitin-protein ligase parkin
Parkinson disease (autosomal recessive
juvenile) 2
parkin 2
parkinson disease protein 2
parkinson juvenile disease protein 2
DU Number: 
Cost of Production: 
pcDNA5frtTO HALO-Parkin
Vector Type: 
Sequence of Insert: 
see attached Snapgene file
Amino Acid Sequence: 
see attached Snapgene file
Price: £110.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Cost Centre: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 


cDNA Synonyms: 
E3 ubiquitin ligase
E3 ubiquitin-protein ligase parkin
Parkinson disease (autosomal recessive
juvenile) 2
parkin 2
parkinson disease protein 2
parkinson juvenile disease protein 2
DU Number: 
pcDNA5frtTO HALO DU 3C-Parkin
Vector Type: 
Sequence of Insert: 
GGATCCGCCACCatgatagtgtttgtcaggttcaactccagccatggttt cccagtggaggtcgattctgacaccagcatcttccagctcaaggaggtgg ttgctaagcgacagggggttccggctgaccagttgcgtgtgattttcgca gggaaggagctgaggaatgactggactgtgcagaattgtgacctggatca gcagagcattgttcacattgtgcagagaccgtggagaaaaggtcaagaaa tgaatgcaactggaggcgacgaccccagaaacgcggcgggaggctgtgag cgggagccccagagcttgactcgggtggacctcagcagctcagtcctccc aggagactctgtggggctggctgtcattctgcacactgacagcaggaagg actcaccaccagctggaagtccagcaggtagatcaatctacaacagcttt tatgtgtattgcaaaggcccctgtcaaagagtgcagccgggaaaactcag ggtacagtgcagcacctgcaggcaggcaacgctcaccttgacccagggtc catcttgctgggatgatgttttaattccaaaccggatgagtggtgaatgc caatccccacactgccctgggactagtgcagaatttttctttaaatgtgg agcacaccccacctctgacaaggaaacatcagtagctttgcacctgatcg caacaaatagtcggaacatcacttgcattacgtgcacagacgtcaggagc cccgtcctggttttccagtgcaactcccgccacgtgatttgcttagactg tttccacttatactgtgtgacaagactcaatgatcggcagtttgttcacg accctcaacttggctactccctgccttgtgtggctggctgtcccaactcc ttgattaaagagctccatcacttcaggattctgggagaagagcagtacaa ccggtaccagcagtatggtgcagaggagtgtgtcctgcagatggggggcg tgttatgcccccgccctggctgtggagcggggctgctgccggagcctgac cagaggaaagtcacctgcgaagggggcaatggcctgggctgtgggtttgc cttctgccgggaatgtaaagaagcgtaccatgaaggggagtgcagtgccg tatttgaagcctcaggaacaactactcaggcctacagagtcgatgaaaga gccgccgagcaggctcgttgggaagcagcctccaaagaaaccatcaagaa aaccaccaagccctgtccccgctgccatgtaccagtggaaaaaaatggag gctgcatgcacatgaagtgtccgcagccccagtgcaggctcgagtggtgc tggaactgtggctgcgagtggaaccgcgtctgcatgggggaccactggtt cgacgtgtagGCGGCCGC
Amino Acid Sequence: 
Price: £110.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Cost Centre: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 


cDNA Synonyms: 
DU Number: 
pGEX6P Halo Thr TAB2 D663-F693(end)
GST-C3-HALO-thr TAB2 D663-F693
NNM_015093.4 GI:296011058
Vector Type: 
Sequence of Insert: 
Amino Acid Sequence: 
Price: £110.00
Completion Time: 
Research Area: 
New Protein: 
Low Temp: 
Hidden Project: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 

SARS-CoV2 (2019-nCoV) Nsp1

DU Number: 
Cost of Production: 
pcDNA5D FRT TO HA SARS-CoV2 (2019-nCoV) Nsp1 M1-N180
HA SARS-CoV2 (2019-nCoV)Nsp1 M1-N180
Vector Type: 
Sequence of Insert: 
see snapgene file
Amino Acid Sequence: 
see snapgene file
Price: £110.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted

SARS-CoV2 (2019-nCoV) Nsp1

DU Number: 
Cost of Production: 
pcDNA5D FRT TO HA SARS-CoV2 (2019-nCoV) Nsp1 M1-N178
HA SARS-CoV2 (2019-nCoV) Nsp1 M1-N178
Vector Type: 
Sequence of Insert: 
see snapgene file
Amino Acid Sequence: 
see snapgene file
Price: £110.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted

SARS-CoV2 (2019-nCoV) Nsp1

DU Number: 
Cost of Production: 
pTXB1 Halo 3C SARS-CoV2 (2019-nCoV) Nsp1 1-179-Intein CBD
Halo 3C SARS-CoV2 (2019-nCoV) Nsp1 1-179-Intein CBD
Vector Type: 
Sequence of Insert: 
see snapgene file
Amino Acid Sequence: 
see snapgene file
Price: £110.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted


cDNA Synonyms: 
DU Number: 
Cost of Production: 
pET28a-HALO-TEV-Malin F33S
Vector Type: 
Sequence of Insert: 
Amino Acid Sequence: 
Price: £110.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Full Snapgene Map: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 


cDNA Synonyms: 
DU Number: 
Cost of Production: 
pET28a-HALO-TEV-Malin C26S
Vector Type: 
Sequence of Insert: 
Amino Acid Sequence: 
Price: £110.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Full Snapgene Map: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 


cDNA Synonyms: 
DU Number: 
Cost of Production: 
Vector Type: 
Sequence of Insert: 
Amino Acid Sequence: 
Price: £110.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Full Snapgene Map: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted
Ubiquitylation Site: 
Reagent Type: 


cDNA Synonyms: 
DU Number: 
pET28a 6His-Halo.TEV-Malin Ala113-Gly395 (delta F215-D233)
His-Halo-GGS-Malin[113-395] (delta F215-D233)
Vector Type: 
Sequence of Insert: 
Amino Acid Sequence: 
Price: £110.00
Completion Time: 
Wild-type or Mutant: 
New Protein: 
Low Temp: 
Hidden Project: 
Cost Centre: 
Extra Protein: 
Cleavage Site: 
Restricted Distribution: 
Not Restricted


Do you need any help? Please get in touch and we’ll be happy to lend a hand.