[field_kinases_species] Recombinant Protein - A20 1-366 [F127C]

Name: A20 1-366 [F127C]
Price per aliquot (100µg): £110.00
Catalog Number (DU Number):
DU29263
Native Sequence:
GCGGCCGCGATGGCTGAACAAGTCCTTCCTCAGGCTTTGTATTTGAGCAA TATGCGGAAAGCTGTGAAGATACGGGAGAGAACTCCAGAAGACATTTTTA AACCTACTAATGGGATCATTCATCATTTTAAAACCATGCACCGATACACA CTGGAAATGTTCAGAACTTGCCAGTTTTGTCCTCAGTTTCGGGAGATCAT CCACAAAGCCCTCATCGACAGAAACATCCAGGCCACCCTGGAAAGCCAGA AGAAACTCAACTGGTGTCGAGAAGTCCGGAAGCTTGTGGCGCTGAAAACG AACGGTGACGGCAATTGCCTCATGCATGCCACTTCTCAGTACATGTGGGG CGTTCAGGACACAGACTTGGTACTGAGGAAGGCGCTGTgCAGCACGCTCA AGGAAACAGACACACGCAACTTTAAATTCCGCTGGCAACTGGAGTCTCTC AAATCTCAGGAATTTGTTGAAACGGGGCTTTGCTATGATACTCGGAACTG GAATGATGAATGGGACAATCTTATCAAAATGGCTTCCACAGACACACCCA TGGCCCGAAGTGGACTTCAGTACAACTCACTGGAAGAAATACACATATTT GTCCTTTGCAACATCCTCAGAAGGCCAATCATTGTCATTTCAGACAAAAT GCTAAGAAGTTTGGAATCAGGTTCCAATTTCGCCCCTTTGAAAGTGGGTG GAATTTACTTGCCTCTCCACTGGCCTGCCCAGGAATGCTACAGATACCCC ATTGTTCTCGGCTATGACAGCCATCATTTTGTACCCTTGGTGACCCTGAA GGACAGTGGGCCTGAAATCCGAGCTGTTCCACTTGTTAACAGAGACCGGG GAAGATTTGAAGACTTAAAAGTTCACTTTTTGACAGATCCTGAAAATGAG ATGAAGGAGAAGCTCTTAAAAGAGTACTTAATGGTGATAGAAATCCCCGT CCAAGGCTGGGACCATGGCACAACTCATCTCATCAATGCCGCAAAGTTGG ATGAAGCTAACTTACCAAAAGAAATCAATCTGGTAGATGATTACTTTGAA CTTGTTCAGCATGAGTACAAGAAATGGCAGGAAAACAGCGAGCAGGGGAG GAGAGAGTAGCACGCCCAGAATCCCATGGAACCTTCCGTGCCCCAGCTTT CTCTCATGGATGTAAAATGTGAAACGCCCAACTGCCCCTTCTTCATGTCT GTGAACACCCAGCCTTTATGCCATGAGTGCTCAGAGAGGCGGCAAAAGAA TCAAAACAAACTCCCAAAGCTGAACTCCAAGCCGGGCCCTGAGGGGCTCC CTGGCATGGCGCTCGGGGCCTCTCGGGGAGAAGCCTATGAGCCCTTGGCG TGGAACCCTGAGGAGTCCACTGGGGGGCCTCATTCGGCCCCACCGACAGC ACCCAGCCCTTTTCTGTTCAGTGAGACCACTGCCATGAAGTGCAGGAGCC CCGGCTGCCCCTTCACACTGAATGTGCAGCACAACGGATTTTGTGAACGT TGCCACAACGCCCGGCAACTTCACGCCAGCCACGCCCCAGACCACACAAG GCACTTGGATCCCGGGAAGTGCCAAGCCTGCCTCCAGGATGTTACCAGGA CATTTAATGGGATCTGCAGTACTTGCTTCAAAAGGACTACAGCAGAGGCC TCCTCCAGCCTCAGCACCAGCCTCCCTCCTTCCTGTCACCAGCGTTCCAA GTCAGATCCCTCGCGGCTCGTCCGGAGCCCCTCCCCGCATTCTTGCCACA GAGCTGGAAACGACGCCCCTGCTGGCTGCCTGTCTCAAGCTGCACGGACT CCTGGGGACAGGACGGGGACGAGCAAGTGCAGAAAAGCCGGCTGCGTGTA TTTTGGGACTCCAGAAAACAAGGGCTTTTGCACACTGTGTTTCATCGAGT ACAGAGAAAACAAACATTTTGCTGCTGCCTCAGGGAAAGTCAGTCCCACA GCGTCCAGGTTCCAGAACACCATTCCGTGCCTGGGGAGGGAATGCGGCAC CCTTGGAAGCACCATGTTTGAAGGATACTGCCAGAAGTGTTTCATTGAAG CTCAGAATCAGAGATTTCATGAGGCCAAAAGGACAGAAGAGCAACTGAGA TCGAGCCAGCGCAGAGATGTGCCTCGAACCACACAAAGCACCTCAAGGCC CAAGTGCGCCCGGGCCTCCTGCAAGAACATCCTGGCCTGCCGCAGCGAGG AGCTCTGCATGGAGTGTCAGCATCCCAACCAGAGGATGGGCCCTGGGGCC CACCGGGGTGAGCCTGCCCCCGAAGACCCCCCCAAGCAGCGTTGCCGGGC CCCCGCCTGTGATCATTTTGGCAATGCCAAGTGCAACGGCTACTGCAACG AATGCTTTCAGTTCAAGCAGATGTATGGCTAAGCGGCCGC

Do you need any help? Please get in touch and we’ll be happy to lend a hand.