cDNA Clone - RAB43

Name: RAB43
Price per aliquot: £110.00
Plasmid:
pMA-RQ RAB43 Nter GFP donor
Full Snapgene Map:
Parent Plasmid:
pMA-RQ
View Parent Plasmid

Snapgene File | Genbank File
ctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtggccgctacagggcgctcccattcgccattcaggctgcgcaactgttgggaagggcgtttcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgacgtaatacgactcactatagggcgaattggcggaaggccgtcaaggccgcatccctgggcctcatgggccttccgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaacatggtcatagctgtttccttgcgtattgggcgctctccgcttcctcgctcactgactcgctgcgctcggtcgttcgggtaaagcctggggtgcctaatgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagaaccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccac
DU Number:
DU60094
Genbank:
Species:
Human
Synonyms:
RAB11B, RAB41
Sequence of Insert:
View Sequence

gctgaggtgggcctgggggcggagtcgaggtcggagctgagggcggagtcgggggcggggacgtaggcggaacccgggtcgggctgaggtgggcccgagggttgggctgggggcggagtgggtgccagcctgagggcggagccgggggcgggcgggggcgggctggggcgggcCTACAGGCCAGACTGGTGTGGCACGGAGCTGAGGACCGGCCGGAGCTTTGCGGAGGGCCCGGCTTGGCgggtccgggggggagccgaacccgcggggcaccgggtccgggcggggccgagccgggccggggcgggagccagccggggtggggcggggccgaggccgagGCAGGCGGTCGGCAGTGCTGGGGGTTCAGGTGTTGCGGCGGCTCCACGTAGCCAGGCGGCCCGTGGGCTGGAGCGGGCGGAGCTCGGCCCGCGGCTTGCGTGAGCTCAGGCCGGTCCCAGCGTCCAGAGCGCCGGCCCTTCGGCTTCTTCTAGGCCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGggcgctggagcgggtgctggagcaggtgcgGCAGGGCCGGGaCCtGGaCCtGGtGACCCGGACGAGCAGTACGATTTCCTGTTCAAGCTcGTGCTcGTGGGCGACGCAAGCGTGGGCAAGACGTGCGTGGTGCAGCGCTTCAAGACCGGCGCCTTCTCGGAGCGCCAGGGAAGCACCATCGGCGTCGACTTCACCATGAAGACGCTGGAGATCCAGGGCAAGCGGGTCAAGGTGGGAGGCCGGCCAGGGCCCCTGGAAGGCGCTCCCTCGGAGGGTGGGGCGGGGGCAGCGGAGCCCCTGGCCGCGGCGAGCGCACCCCGCGTCCATCTGAAGTTTCCTTTGGCTTCCCCTTTTTCCTTCCTCGGGTCGGAGCAGGCCTGGGCCCCGGGGTCTGGGCCGGGTTCAAGTCCTCAAAGCGCCGGCCGTGGGTTGCTggggggggggggggCGAGGGAGTGTGGAGGAGGCGGCCCTGCCCTCCGGAGCTCACACCCTAGGAGGGGACTGTGCTCCAAAATAACTTTAGCCATTGGAAGGCAGGGGGTTAGACTCCCCTGTTCCAGGTACTAGCGGAGCGCCTTGGAGTGCGGAGATCA
Amino Acid Sequence:
View Sequence

Antibiotic:
Amp
Low Growth Temperature Requirement?:
No
Comments:
CRISPR Nter GFP donor, use in conjunction with guide pairs 60008/60012 or 60009/60013.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.