cDNA Clone ABIN1 guide RNA cloning

• Synonyms: TNIP1
• Plasmid: pU6 ABIN1 Cter gRNA
• Parent Plasmid: pU6 gRNA
• Expressed: ABIN1 Cter gRNA
• Genbank: ENSG00000145901
• Species: Human

Sequence of Insert

GATGGAAGAGGCGCGAGTTG(GGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48085
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses ABIN1 guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets exon 16 on reverse strand.