cDNA Clone MYSM1

• Synonyms: 2A-DUB, 2ADUB
• Plasmid: pU6 MYSM1 Nter gRNA
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: MYSM1 Nter gRNA
• Genbank: ENSG00000162601
• Species: Human

Sequence of Insert

GAGGCGGATGTGGATATCGA(AGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48210
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses MYSM1 guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets coding region of exon 1.