cDNA Clone MYSM1

• Synonyms: 2A-DUB, 2ADUB
• Plasmid: pU6 MYSM1 Cter gRNA
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: MYSM1 Cter gRNA
• Genbank: ENSG00000162601
• Species: Human

Sequence of Insert

GCAAAGTGACCAATTGCTTTA(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48211
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses MYSM1 guide RNA, 21mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets coding region of last exon (exon 20).