cDNA Clone DCUN1D1

• Synonyms: DCNL1, DCUN1L1, RP42, SCCRO, SCRO, Tes3
• Plasmid: pU6 DCUN1D1 gRNA B
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: DCUN1D1 gRNA B
• Genbank: ENSG00000043093
• Species: Human

Sequence of Insert

GTGTAAAAGGATCATTGGAC(AGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48391
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses DCUN1D1 guide RNA B, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets coding region in exon 2, to be used in conjunction with DCUN1D1 guide RNA A, a ssDNA KO donor and Cas9 nickase. PAM site is situated on the sense strand.