cDNA Clone DCUN1D4

• Plasmid: pU6 DCUN1D4 gRNA A
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: DCUN1D4 gRNA A
• Genbank: ENSG00000109184
• Species: Human

Sequence of Insert

GATAAATCATCTCCAGAGGC(AGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48396
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses DCUN1D4 guide RNA A, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets 1st common coding exon (4), PAM site is situated on the antisense strand. To be used in conjunction with DCUN1D4 guide RNA B, a ssDNA KO donor and Cas9 nickase.