cDNA Clone EGR2

• Synonyms: AT591, CMT1D, CMT4E, KROX20
• Plasmid: pU6 EGR2 gRNA B
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: EGR2 gRNA B
• Genbank: NM_000399.3
• Species: Human

Sequence of Insert

gtccgggtccgagaggagca(agg)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48410
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses EGR2 C-terminal guide RNA B, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets the end of the coding region in exon 2, PAM site situated on antisense strand. Designed to introduce a C-terminal GFP tag via CRISPR in conjunction with wild-type Cas9 and the GFP donor plasmid DU48460. To be screened for using FACs, recombination rates should be increased if this guide is used along with guide A DU48409.