cDNA Clone ABIN1

• Synonyms: TNIP1, ABIN-1, NAF1, VAN, nip40-1
• Plasmid: pU6 ABIN1 Nter sense KI gRNA
• Parent Plasmid: pU6 gRNA BamHI
• Expressed: ABIN1 Nter sense KI guide RNA
• Genbank: NM_001252385.1
• Species: Human

Sequence of Insert

GCTACCCTCATGGAAGGGAG(AGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48486
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses ABIN1 Nter KI guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets close to the ATG start codon in exon 2, PAM site situated on sense strand. Designed to introduce a GFP tag to Abin1 via CRISPR when used in conjunction with the donor plasmid DU48524. To be used in conjunction with the paired guide DU48506 to allow recombination using either wild-type or D10A nickase Cas9. To be screened for using GFP followed by downstream PCR and Western analysis.