cDNA Clone OSR1

• Synonyms: ODD, OXSR1
• Plasmid: pX335 OSR1 KI antisense
• Parent Plasmid: pX335
• Expressed: OSR1 KI antisense guide
• Genbank: NP_005100
• Species: Human

Sequence of Insert

GCAGGCCGTTCACTGCCTGA(AGG)

• Vector Type: Other
• Antibiotic: Amp
• DU Number: DU48770
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets antisense strand in first common coding exon (exon 2). May be used to KI at the N-terminus if used in conjunction with sense guide 48766 and the donor plasmid 48716. Guide sequence shown as sequence of insert with PAM in brackets. Positives may be enriched for with puromycin prior to further selection using FACs sorting for GFP expression.