cDNA Clone LRRK2 (mouse)

• Synonyms: 4921513O20Rik, 9330188B09Rik, AW561911, D630001M17Rik, Gm927, cI-46
• Plasmid: pKN7 LRRK2m KO sense
• Parent Plasmid: pKN7
• Expressed: LRRK2m KO sense guide
• Genbank: NM_025730.3
• Species: Mouse

Sequence of Insert

GCGCCTGTCAGGGCTGCGAAG

• Vector Type: Mammalian
• Antibiotic: Kan
• DU Number: DU48891
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand in exon 1, designed to KO LRRK2m when co-transfected with antisense guide 48894. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty flp-in line is preferable as this allows for downstream rescue and mutant analysis if necessary.