cDNA Clone COL1A1

• Synonyms: EDSC, OI1, OI2, OI3, OI4
• Plasmid: pBABED P U6 COL1A1 Nter KI sense
• Parent Plasmid: pBABED P U6
• Expressed: COL1A1 Nter KI sense guide
• Genbank: ENSG00000108821
• Species: Human

Sequence of Insert

GCCACCGCCCTCCTGACGCA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52286
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR N-terminal KI guide, use in conjunction with 52305 and a suitable donor.