cDNA Clone OSR1

• Synonyms: Odd1, Osr, OXSR1
• Plasmid: pBABED P U6 OSR1 ex2 KO sense B
• Parent Plasmid: pBABED P U6
• Expressed: OSR1 ex2 KO sense guide B
• Genbank: ENSG00000143867
• Species: Human

Sequence of Insert

GGGCACGGTGTCCAGCTTGG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52418
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide, use in conjunction with 52424. Use in preference to earlier guide pairs.