cDNA Clone - ZNRF2

Name: ZNRF2
Price per aliquot: £110.00
Parent Plasmid:
View Parent Plasmid

Snapgene File | Genbank File
DU Number:
Sequence of Insert:
View Sequence

ggatccatgggcgccaaacagagcggcccggccgccgctaacggccgcacgcgcgcgtactcgggctcggatctaccttccagtagcagcggaggcgccaatgggaccgcgggcggcggcgggggcgctcgggccgccgccgcggggaggttcccggctcaggtgcccagcgcgcaccagcccagcgcctccggcggcgccgcggcggccgcggcggccccggcagccccggcggccccgcgcagccgctccctcggcggggccgtggggagcgtggcgtcgggggcccgcgcggcgcagtccccc ttcagcatcccgaacagcagcagcggcccgtacggctcgcaggactcggt gcacagcagccctgaggacggcggcggcggccgggaccggccggtgggcg ggagccccggcgggccgcgcctggtgatcggctccttaccagctcacctc tcgccgcacatgtttggaggatttaagtgccctgtatgctcaaaatttgt atcctcagatgaaatggatttgcatcttgtaatgtgtttaacaaagccac gaataacctataatgaggatgtactgagtaaagatgctggggaatgtgca atatgccttgaagaattgcagcagggagatactatagcacgactgccttg tctatgcatatatcataaaggctgcatagatgaatggtttgaagtaaata gatcttgccctgagcacccttcagattaaggatcc
Amino Acid Sequence:
View Sequence

All ZNRF2 plasmids MUST be grown at 30 degrees C or less to prevent recombination.

Do you need any help? Please get in touch and we’ll be happy to lend a hand.